You are viewing an incomplete version of our website. Please click to reload the website as full version.

Expression Vectors

938,610 Products
Data Quality
  • 2026
  • 938610
  • 1005
  • 267
  • 241
  • 224
  • 210
  • 335493
  • 331727
  • 181065
  • 19989
  • 18117
  • 689360
  • 210070
  • 39144
  • 36
  • 691356
    Mammalian Expression Vector
  • 250937
  • 247254
    Bacterial Expression Vector
  • 161881
  • 87096
Vector Backbone
  • 62464
  • 62463
  • 62463
  • 62463
  • 61225
Fusion tag
  • 210145
  • 216583
  • 91627
  • 61225
  • 61224
Bacterial Resistance
  • 713272
  • 225338
Selectable Marker
  • 336119
  • 179829
  • 57
  • 401035
  • 277612
  • 264119
  • 39145
  • 3184
Expression Type
  • 508331
  • 427083
  • 34644
  • 3174
  • 10
  • 652177
  • 366223
  • 39144
  • 27
  • 26
Supplier: Log in to see

Untagged full-length cDNA clone from Human IL8 is ideal for over-expression of native protein for functional studies.

Protein Expression
Interleukin 8
NCBI Accession:
NM_000584, NP_000575
IL8L1, il8, IL8, LOC422654, Cxcl15, Il8, IL8L2, IL*08-02
Insert length:
1690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Balakathiresan, Bhattacharyya, Gutti, Long, Jozwik, Huang, Srivastava, Pollard, Biswas: "Tristetraprolin regulates IL-8 mRNA stability in cystic fibrosis lung epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 296, Issue 6, pp. L1012-8, 2009 (Pubmed)
Catalog No. ABIN3384619
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MDH1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Malate Dehydrogenase 1, NAD (Soluble)
NCBI Accession:
NM_005917, NP_005908
mdh5, LOC100280767, Mdh1, MDH1, mdh1
Insert length:
1370 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Stiebler, Freitag, Schink, Stehlik, Tillmann, Ast, Bölker: "Ribosomal readthrough at a short UGA stop codon context triggers dual localization of metabolic enzymes in Fungi and animals." in: PLoS genetics, Vol. 10, Issue 10, pp. e1004685, 2014 (Pubmed)
Catalog No. ABIN3385064
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOX is ideal for over-expression of native protein for functional studies.

Protein Expression
Lysyl Oxidase
NCBI Accession:
NM_002317, NP_002308
LOX, lox, Lox, LOC100357045
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ruiz, Báez-Vega, Ruiz, Peterse, Monteiro, Bracero, Beauchamp, Fazleabas, Flores: "Dysregulation of Lysyl Oxidase Expression in Lesions and Endometrium of Women With Endometriosis." in: Reproductive sciences (Thousand Oaks, Calif.), Vol. 22, Issue 12, pp. 1496-508, 2015 (Pubmed)
  • Okkelman, Sukaeva, Kirukhina, Korneenko, Pestov: "Nuclear translocation of lysyl oxidase is promoted by interaction with transcription repressor p66β." in: Cell and tissue research, Vol. 358, Issue 2, pp. 481-9, 2014 (Pubmed)
Catalog No. ABIN3384901
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LOXL2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Lysyl Oxidase-Like 2
NCBI Accession:
NM_002318, NP_002309
lox2, LOXL2, loxl2, Loxl2
Insert length:
3550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • de Jong, van Balkom, Gremmels, Verhaar: "Exosomes from hypoxic endothelial cells have increased collagen crosslinking activity through up-regulation of lysyl oxidase-like 2." in: Journal of cellular and molecular medicine, Vol. 20, Issue 2, pp. 342-50, 2016 (Pubmed)
  • Wong, Tse, Huang, Zhu, Chiu, Lai, Au, Kai, Lee, Wei, Tsang, Lo, Shi, Zheng, Wong, Ng: "Lysyl oxidase-like 2 is critical to tumor microenvironment and metastatic niche formation in hepatocellular carcinoma." in: Hepatology (Baltimore, Md.), Vol. 60, Issue 5, pp. 1645-58, 2014 (Pubmed)
  • Xu, Go, Finney, Moon, Lantz, Rebecchi, Desaire, Mure: "Post-translational modifications of recombinant human lysyl oxidase-like 2 (rhLOXL2) secreted from Drosophila S2 cells." in: The Journal of biological chemistry, Vol. 288, Issue 8, pp. 5357-63, 2013 (Pubmed)
  • Bignon, Pichol-Thievend, Hardouin, Malbouyres, Bréchot, Nasciutti, Barret, Teillon, Guillon, Etienne, Caron, Joubert-Caron, Monnot, Ruggiero, Muller, Germain: "Lysyl oxidase-like protein-2 regulates sprouting angiogenesis and type IV collagen assembly in the endothelial basement membrane." in: Blood, Vol. 118, Issue 14, pp. 3979-89, 2011 (Pubmed)
Catalog No. ABIN3384902
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAT2A is ideal for over-expression of native protein for functional studies.

Protein Expression
Methionine Adenosyltransferase II, alpha
NCBI Accession:
NM_005911, NP_005902
mat2a, MAT2A, Mat2a, mat2aa
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Nordgren, Peng, Pelleymounter, Moon, Abo, Feng, Eckloff, Yee, Wieben, Weinshilboum: "Methionine adenosyltransferase 2A/2B and methylation: gene sequence variation and functional genomics." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 39, Issue 11, pp. 2135-47, 2011 (Pubmed)
Catalog No. ABIN3385037
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MAX is ideal for over-expression of native protein for functional studies.

Protein Expression
MYC Associated Factor X
NCBI Accession:
NM_145112, NP_660087
Max, max-a, MAX, max, max-b
Insert length:
2210 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ikeda, Pak, Chavez, Ryan: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, 2015 (Pubmed)
Catalog No. ABIN3385041
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MCCC1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Methylcrotonoyl-CoA Carboxylase 1 (Alpha)
NCBI Accession:
NM_020166, NP_064551
MCCC1, Mccc1, MCCA
Insert length:
2620 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Ingaramo, Beckett: "Selectivity in post-translational biotin addition to five human carboxylases." in: The Journal of biological chemistry, Vol. 287, Issue 3, pp. 1813-22, 2012 (Pubmed)
Catalog No. ABIN3385055
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PSMC5 is ideal for over-expression of native protein for functional studies.

Protein Expression
Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5
NCBI Accession:
NM_002805, NP_002796
Psmc5, PSMC5, psmc5, TBP10
Insert length:
1430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Chen, Laurenzana, Coslo, Chen, Omiecinski: "Proteasomal interaction as a critical activity modulator of the human constitutive androstane receptor." in: The Biochemical journal, Vol. 458, Issue 1, pp. 95-107, 2014 (Pubmed)
Catalog No. ABIN3386114
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RBBP9 is ideal for over-expression of native protein for functional studies.

Protein Expression
Retinoblastoma Binding Protein 9
NCBI Accession:
NM_006606, NP_006597
RBBP9, rbbp9, Rbbp9
Insert length:
2590 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Shields, Niessen, Murphy, Mielgo, Desgrosellier, Lau, Barnes, Lesperance, Bouvet, Tarin, Cravatt, Cheresh: "RBBP9: a tumor-associated serine hydrolase activity required for pancreatic neoplasia." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 5, pp. 2189-94, 2010 (Pubmed)
Catalog No. ABIN3386291
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PTBP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Polypyrimidine Tract Binding Protein 2
NCBI Accession:
NM_021190, NP_067013
PTBP2, LOC100349676, Ptbp2, ptbp2b
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yip, Fuhlbrigge, Taylor, Creusot, Nishikawa-Matsumura, Whiting, Schartner, Akter, von Herrath, Fathman: "Inflammation and hyperglycemia mediate Deaf1 splicing in the pancreatic lymph nodes via distinct pathways during type 1 diabetes." in: Diabetes, Vol. 64, Issue 2, pp. 604-17, 2015 (Pubmed)
Catalog No. ABIN3386141
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RGS4 is ideal for over-expression of native protein for functional studies.

Protein Expression
Regulator of G-Protein Signaling 4
NCBI Accession:
NM_005613, NP_005604
RGS4, Rgs4
Insert length:
2740 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Iankova, Chavey, Clapé, Colomer, Guérineau, Grillet, Brunet, Annicotte, Fajas: "Regulator of G protein signaling-4 controls fatty acid and glucose homeostasis." in: Endocrinology, Vol. 149, Issue 11, pp. 5706-12, 2008 (Pubmed)
Catalog No. ABIN3386364
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Protein Expression
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Solute Carrier Family 22 (Organic Cation Transporter), Member 2
NCBI Accession:
NM_003058, NP_003049
OCT2, SLC22A2, Slc22a2
Insert length:
2400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, Issue , pp. 90-8, 2014 (Pubmed)
  • Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, 2013 (Pubmed)
  • Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, 2008 (Pubmed)
Catalog No. ABIN3386748
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ribonucleotide Reductase M1
NCBI Accession:
NM_001033, NP_001024
RRM1, RnrL, rrm1, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD1 is ideal for over-expression of native protein for functional studies.

Protein Expression
SMAD, Mothers Against DPP Homolog 1
NCBI Accession:
NM_005900, NP_005891
smad1, SMAD1, Mad, Smad1, smad1-a
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Trinh, Barengo, Naora: "Homeodomain protein DLX4 counteracts key transcriptional control mechanisms of the TGF-? cytostatic program and blocks the antiproliferative effect of TGF-?." in: Oncogene, Vol. 30, Issue 24, pp. 2718-29, 2011 (Pubmed)
Catalog No. ABIN3386826
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD4 is ideal for over-expression of native protein for functional studies.

Protein Expression
SMAD Family Member 4
NCBI Accession:
NM_005359, NP_005350
SMAD4, smad4, LOC100342294, Smad4, smad4.1
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386828
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGCE is ideal for over-expression of native protein for functional studies.

Protein Expression
Sarcoglycan, epsilon
NCBI Accession:
NM_003919, NP_003910
sgce, SGCE, Sgce
Insert length:
1470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Esapa, Waite, Locke, Benson, Kraus, McIlhinney, Sillitoe, Beesley, Blake: "SGCE missense mutations that cause myoclonus-dystonia syndrome impair epsilon-sarcoglycan trafficking to the plasma membrane: modulation by ubiquitination and torsinA." in: Human molecular genetics, Vol. 16, Issue 3, pp. 327-42, 2007 (Pubmed)
Catalog No. ABIN3386694
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SGK1 is ideal for over-expression of native protein for functional studies.

Protein Expression
serum/glucocorticoid Regulated Kinase 1
NCBI Accession:
NM_005627, NP_005618
SGK1, Sgk1, sgk1
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Zhong, Oguljahan, Xiao, Nelson, Hernandez, Garcia-Barrio, Francis: "Serum and glucocorticoid-regulated kinase 1 promotes vascular smooth muscle cell proliferation via regulation of β-catenin dynamics." in: Cellular signalling, Vol. 26, Issue 12, pp. 2765-72, 2014 (Pubmed)
  • Chen, Tagliaferro, Kareva, Yarygina, Kholodilov, Burke: "Neurotrophic effects of serum- and glucocorticoid-inducible kinase on adult murine mesencephalic dopamine neurons." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 32, Issue 33, pp. 11299-308, 2012 (Pubmed)
  • Arteaga, Alvarez de la Rosa, Alvarez, Canessa: "Multiple translational isoforms give functional specificity to serum- and glucocorticoid-induced kinase 1." in: Molecular biology of the cell, Vol. 18, Issue 6, pp. 2072-80, 2007 (Pubmed)
Catalog No. ABIN3386695
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SAE1 is ideal for over-expression of native protein for functional studies.

Protein Expression
SUMO1 Activating Enzyme Subunit 1
NCBI Accession:
NM_005500, NP_005491
ARHGAP31, SAE1, Sae1, sae1
Insert length:
2050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Kho, Lee, Jeong, Oh, Gorski, Fish, Sanchez, DeVita, Christensen, Dahl, Hajjar: "Small-molecule activation of SERCA2a SUMOylation for the treatment of heart failure." in: Nature communications, Vol. 6, Issue , pp. 7229, 2015 (Pubmed)
Catalog No. ABIN3386574
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SATB1 is ideal for over-expression of native protein for functional studies.

Protein Expression
SATB Homeobox 1
NCBI Accession:
NM_002971, NP_002962
SATB1, satb1, Satb1
Insert length:
2820 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Grzanka, Izdebska, Klimaszewska-Wisniewska, Gagat: "The alterations in SATB1 and nuclear F-actin expression affect apoptotic response of the MCF-7 cells to geldanamycin." in: Folia histochemica et cytobiologica, Vol. 53, Issue 1, pp. 79-87, 2015 (Pubmed)
  • Grzanka, Kowalczyk, Izdebska, Klimaszewska-Wisniewska, Gagat: "The interactions between SATB1 and F-actin are important for mechanisms of active cell death." in: Folia histochemica et cytobiologica, Vol. 53, Issue 2, pp. 152-61, 2015 (Pubmed)
  • Nagpal, Ahmad, Molparia, Kulshreshtha: "MicroRNA-191, an estrogen-responsive microRNA, functions as an oncogenic regulator in human breast cancer." in: Carcinogenesis, Vol. 34, Issue 8, pp. 1889-99, 2013 (Pubmed)
  • Wang, Su, Zhou, Tu, Zhang, Jiang, Zhou: "Deficiency of SATB1 expression in Sezary cells causes apoptosis resistance by regulating FasL/CD95L transcription." in: Blood, Vol. 117, Issue 14, pp. 3826-35, 2011 (Pubmed)
Catalog No. ABIN3386585
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCD is ideal for over-expression of native protein for functional studies.

Protein Expression
Stearoyl-CoA Desaturase (Delta-9-Desaturase)
NCBI Accession:
NM_005063, NP_005054
scd, SCD, Desat1, Desat3, CIMG_08158, VIBHAR_06094, acod, LOC100346561, Scd, Scd1, SCD1
Insert length:
5150 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lu, Zhou, Tao, Dou, Gao, Liu: "Overexpression of stearoyl-CoA desaturase 1 in bone marrow mesenchymal stem cells enhance the expression of induced endothelial cells." in: Lipids in health and disease, Vol. 13, Issue , pp. 53, 2014 (Pubmed)
Catalog No. ABIN3386597
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF13 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ring Finger Protein 13
NCBI Accession:
NM_007282, NP_009213
RNF13, Rnf13, rnf13
Insert length:
2360 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • van Dijk, Yamazaki, Palmer: "Tumour-associated mutations of PA-TM-RING ubiquitin ligases RNF167/RNF13 identify the PA domain as a determinant for endosomal localization." in: The Biochemical journal, Vol. 459, Issue 1, pp. 27-36, 2014 (Pubmed)
Catalog No. ABIN3386403
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC33A1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Solute Carrier Family 33 Member 1
NCBI Accession:
NM_004733, NP_004724
slc33a1, SLC33A1, Slc33a1
Insert length:
2640 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Peng, Li, Clarkson, Pehar, Lao, Hillmer, Barnhart, Christian, Mitchell, Bendlin, Sandor, Puglielli: "Deficient import of acetyl-CoA into the ER lumen causes neurodegeneration and propensity to infections, inflammation, and cancer." in: The Journal of neuroscience : the official journal of the Society for Neuroscience, Vol. 34, Issue 20, pp. 6772-89, 2014 (Pubmed)
  • Pehar, Jonas, Hare, Puglielli: "SLC33A1/AT-1 protein regulates the induction of autophagy downstream of IRE1/XBP1 pathway." in: The Journal of biological chemistry, Vol. 287, Issue 35, pp. 29921-30, 2012 (Pubmed)
  • Jonas, Pehar, Puglielli: "AT-1 is the ER membrane acetyl-CoA transporter and is essential for cell viability." in: Journal of cell science, Vol. 123, Issue Pt 19, pp. 3378-88, 2010 (Pubmed)
Catalog No. ABIN3386779
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMAD2 is ideal for over-expression of native protein for functional studies.

Protein Expression
SMAD, Mothers Against DPP Homolog 2
NCBI Accession:
NM_005901, NP_005892
SMAD2, smad2, Smad2
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Tone, Furuuchi, Kojima, Tykocinski, Greene, Tone: "Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer." in: Nature immunology, Vol. 9, Issue 2, pp. 194-202, 2008 (Pubmed)
Catalog No. ABIN3386827
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Protein Expression
Speckle-Type POZ Protein
NCBI Accession:
NM_003563, NP_003554
spop, SPOP, Bm1_45730, spop-b, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TBXAS1 is ideal for over-expression of native protein for functional studies.

Protein Expression
thromboxane A Synthase 1 (Platelet)
NCBI Accession:
NM_001061, NP_001052
PTRG_00454, PTRG_06796, thas, TBXAS1, tbxas1, Tbxas1
Insert length:
1960 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Meling, Zelasko, Kambalyal, Roy, Das: "Functional role of the conserved i-helix residue I346 in CYP5A1-Nanodiscs." in: Biophysical chemistry, Vol. 200-201, Issue , pp. 34-40, 2015 (Pubmed)
  • Das, Varma, Mularczyk, Meling: "Functional investigations of thromboxane synthase (CYP5A1) in lipid bilayers of nanodiscs." in: Chembiochem : a European journal of chemical biology, Vol. 15, Issue 6, pp. 892-9, 2014 (Pubmed)
  • Huang, Chu, Huang, Chen, Jiang, Zhang, Zeng: "18β-Glycyrrhetinic acid suppresses cell proliferation through inhibiting thromboxane synthase in non-small cell lung cancer." in: PLoS ONE, Vol. 9, Issue 4, pp. e93690, 2014 (Pubmed)
Catalog No. ABIN3387157
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human STAT6 is ideal for over-expression of native protein for functional studies.

Protein Expression
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced
NCBI Accession:
NM_003153, NP_003144
STAT6, Stat6, LOC100859543
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • White, Martin, Abe, Marroquin, Stern, Fu: "Insulin receptor substrate-1/2 mediates IL-4-induced migration of human airway epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 297, Issue 1, pp. L164-73, 2009 (Pubmed)
Catalog No. ABIN3387017
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ASS1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Argininosuccinate Synthase 1
NCBI Accession:
NM_054012, NP_446464
ASS1, ass1, Ass1
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Battisti, Valente, Albonici, Bei, Modesti, Palumbo: "Nutritional stress and arginine auxotrophy confer high sensitivity to chloroquine toxicity in mesothelioma cells." in: American journal of respiratory cell and molecular biology, Vol. 46, Issue 4, pp. 498-506, 2012 (Pubmed)
Catalog No. ABIN3377117
1 kit
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CDA is ideal for over-expression of native protein for functional studies.

Protein Expression
Cytidine Deaminase
NCBI Accession:
NM_001785, NP_001776
CDA, cda, CDD1, cdd, cdd-1, cdd-2, CNC04940, Tb09.160.1680, Cda
Insert length:
910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Bacterial Resistance:
Enhanced CMV Promoter,T7 Promoter
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Sharma, Patnaik, Taggart, Kannisto, Enriquez, Gollnick, Baysal: "APOBEC3A cytidine deaminase induces RNA editing in monocytes and macrophages." in: Nature communications, Vol. 6, Issue , pp. 6881, 2015 (Pubmed)
Catalog No. ABIN3377397
1 kit
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...