Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,026,916 Products
Data Quality
  • 2026
Type
  • 1026916
    Plasmid
Gene
  • 1005
  • 297
  • 290
  • 253
  • 242
Species
  • 403781
  • 335493
  • 197298
  • 19989
  • 18117
Insert
  • 689354
  • 298383
  • 39144
  • 35
Vector
  • 779664
    Mammalian Expression Vector
  • 565440
  • 247252
    Bacterial Expression Vector
  • 161881
  • 87096
Vector Backbone
  • 108734
  • 62463
  • 62462
  • 62462
  • 62461
Fusion tag
  • 210143
  • 216580
  • 93600
  • 91625
  • 61225
Resistance Gene
  • 767687
  • 259229
Selectable Marker
  • 370007
  • 179829
  • 57
Promoter
  • 401033
  • 365922
  • 264116
  • 39145
  • 3184
Expression Type
  • 596640
  • 427080
  • 68536
  • 3174
  • 10
Application
  • 740486
  • 366220
  • 39144
  • 26
  • 26
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
NM_021972,NP_068807
Species:
Human
Synonyms:
Sk1, SPHK1, sphk1.L, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Uncoupling Protein 2 (Mitochondrial, Proton Carrier) (UCP2)
NCBI Accession:
NM_003355,NP_003346
Species:
Human
Synonyms:
PTRG_09289, UCP2, LOC100282746, ucp2.L, ucp2, ucp1, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 9 (SOX9)
NCBI Accession:
NM_000346,NP_000337
Species:
Human
Synonyms:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
NM_001730,NP_001721
Species:
Human
Synonyms:
KLF5, klf5.S, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GSTA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Glutathione S-Transferase alpha 2 (GSTa2)
NCBI Accession:
NM_000846,NP_000837
Species:
Human
Synonyms:
GSTA2, Gsta2, Gsta5, Gsta
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Venkataraman, den Braver, Vermeulen, Commandeur: "Cytochrome P450-mediated bioactivation of mefenamic acid to quinoneimine intermediates and inactivation by human glutathione S-transferases." in: Chemical research in toxicology, Vol. 27, Issue 12, pp. 2071-81, 2014 (Pubmed)
Catalog No. ABIN3378293
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ID4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Inhibitor of DNA Binding 4, Dominant Negative Helix-Loop-Helix Protein (ID4)
NCBI Accession:
NM_001546,NP_001537
Species:
Human
Synonyms:
Id4, id4, id4.S, ID4
Insert length:
3100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Weng, Nguyen, Shively: "miRNA-342 Regulates CEACAM1-induced Lumen Formation in a Three-dimensional Model of Mammary Gland Morphogenesis." in: The Journal of biological chemistry, Vol. 291, Issue 32, pp. 16777-86, 2016 (Pubmed)
  • Nguyen, Shively: "Induction of Lumen Formation in a Three-dimensional Model of Mammary Morphogenesis by Transcriptional Regulator ID4: ROLE OF CaMK2D IN THE EPIGENETIC REGULATION OF ID4 GENE EXPRESSION." in: The Journal of biological chemistry, Vol. 291, Issue 32, pp. 16766-76, 2016 (Pubmed)
Catalog No. ABIN3378425
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kruppel-Like Factor 2 (Lung) (KLF2)
NCBI Accession:
NM_016270,NP_057354
Species:
Human
Synonyms:
klf2, KLF2, Klf2, klf2.S
Insert length:
1720 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Piva, Deaglio, Famà, Buonincontri, Scarfò, Bruscaggin, Mereu, Serra, Spina, Brusa, Garaffo, Monti, Dal Bo, Marasca, Arcaini, Neri, Gattei, Paulli, Tiacci, Bertoni, Pileri, Foà, Inghirami, Gaidano et al.: "The Krüppel-like factor 2 transcription factor gene is recurrently mutated in splenic marginal zone lymphoma. ..." in: Leukemia, Vol. 29, Issue 2, pp. 503-7, 2015 (Pubmed)
  • Lee, Youn, Cho, Kwon, Lee, Kim, Park, Oh, Kim: "FOXO1 impairs whereas statin protects endothelial function in diabetes through reciprocal regulation of Kruppel-like factor 2." in: Cardiovascular research, Vol. 97, Issue 1, pp. 143-52, 2012 (Pubmed)
Catalog No. ABIN3378605
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human DHX30 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
DEAH (Asp-Glu-Ala-His) Box Polypeptide 30 (DHX30)
NCBI Accession:
NM_014966,NP_055781
Species:
Human
Synonyms:
DHX30, dhx30, dhx30.S, Dhx30
Insert length:
3670 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Bogenhagen: "Human mitochondrial DNA nucleoids are linked to protein folding machinery and metabolic enzymes at the mitochondrial inner membrane." in: The Journal of biological chemistry, Vol. 281, Issue 35, pp. 25791-802, 2006 (Pubmed)
Catalog No. ABIN3377738
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LDB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
LIM Domain Binding 1 (LDB1)
NCBI Accession:
NM_003893,NP_003884
Species:
Human
Synonyms:
ldb1.L, Ldb1, LDB1, xldb1, ldb1b
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Johnsen, Güngör, Prenzel, Riethdorf, Riethdorf, Taniguchi-Ishigaki, Rau, Tursun, Furlow, Sauter, Scheffner, Pantel, Gannon, Bach: "Regulation of estrogen-dependent transcription by the LIM cofactors CLIM and RLIM in breast cancer." in: Cancer research, Vol. 69, Issue 1, pp. 128-36, 2009 (Pubmed)
Catalog No. ABIN3378659
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LEO1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leo1, Paf1/RNA Polymerase II Complex Component, Homolog (S. Cerevisiae) (LEO1)
NCBI Accession:
NM_138792,NP_620147
Species:
Human
Synonyms:
LEO1, leo1, LOC100466503, leo1.S, Leo1, LOC415420, LOC478310
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Rozenblatt-Rosen, Hughes, Nannepaga, Shanmugam, Copeland, Guszczynski, Resau, Meyerson: "The parafibromin tumor suppressor protein is part of a human Paf1 complex." in: Molecular and cellular biology, Vol. 25, Issue 2, pp. 612-20, 2005 (Pubmed)
Catalog No. ABIN3378663
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LETM1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leucine Zipper-EF-Hand Containing Transmembrane Protein 1 (LETM1)
NCBI Accession:
NM_012318,NP_036450
Species:
Human
Synonyms:
LETM1, letm1, LOC100346816, Letm1
Insert length:
4470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Hart, Rauch, Carr, Vermeesch, ODriscoll: "LETM1 haploinsufficiency causes mitochondrial defects in cells from humans with Wolf-Hirschhorn syndrome: implications for dissecting the underlying pathomechanisms in this condition." in: Disease models & mechanisms, Vol. 7, Issue 5, pp. 535-45, 2014 (Pubmed)
Catalog No. ABIN3378667
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LIPG is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lipase, Endothelial (LIPG)
NCBI Accession:
NM_006033,NP_006024
Species:
Human
Synonyms:
LIPG, lipg, lipg.L, CpipJ_CPIJ004802, lipe, LOC509808, Lipg
Insert length:
3890 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Singaraja, Sivapalaratnam, Hovingh, Dubé, Castro-Perez, Collins, Adelman, Riwanto, Manz, Hubbard, Tietjen, Wong, Mitnaul, van Heek, Lin, Roddy, McEwen, Dallinge-Thie, van Vark-van der Zee, Verwoert et al.: "The impact of partial and complete loss-of-function mutations in endothelial lipase on high-density lipoprotein levels and functionality in humans. ..." in: Circulation. Cardiovascular genetics, Vol. 6, Issue 1, pp. 54-62, 2013 (Pubmed)
Catalog No. ABIN3378689
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LONP1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lon Peptidase 1, Mitochondrial (LONP1)
NCBI Accession:
NM_004793,NP_004784
Species:
Human
Synonyms:
LONP1, lonp1, Lonp1, PIM1
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Luo, Wang, Hou, Hu, Jia, Qin, Zuo, Liu, Luo, Song, Wang, Pang: "ATP-Dependent Lon Protease Contributes to Helicobacter pylori-Induced Gastric Carcinogenesis." in: Neoplasia (New York, N.Y.), Vol. 18, Issue 4, pp. 242-52, 2016 (Pubmed)
Catalog No. ABIN3378720
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LPGAT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysophosphatidylglycerol Acyltransferase 1 (LPGAT1)
NCBI Accession:
NM_014873,NP_055688
Species:
Human
Synonyms:
lpgat1.S, LPGAT1, lpgat1, Lpgat1
Insert length:
1800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhao, Chen, Li, Konrad, Cao: "The microsomal cardiolipin remodeling enzyme acyl-CoA lysocardiolipin acyltransferase is an acyltransferase of multiple anionic lysophospholipids." in: Journal of lipid research, Vol. 50, Issue 5, pp. 945-56, 2009 (Pubmed)
Catalog No. ABIN3378727
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ELK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ELK1, Member of ETS Oncogene Family (ELK1)
NCBI Accession:
NM_005229,NP_005220
Species:
Human
Synonyms:
ELK1, Elk1, Tsp_02690, elk1, elk1.S
Insert length:
2800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Patki, Chari, Sivakumaran, Gonit, Trumbly, Ratnam: "The ETS domain transcription factor ELK1 directs a critical component of growth signaling by the androgen receptor in prostate cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 16, pp. 11047-65, 2013 (Pubmed)
  • Zhang, Zhang, Gao, Wang, Liu: "Regulation of the microRNA 200b (miRNA-200b) by transcriptional regulators PEA3 and ELK-1 protein affects expression of Pin1 protein to control anoikis." in: The Journal of biological chemistry, Vol. 288, Issue 45, pp. 32742-52, 2013 (Pubmed)
  • Reichman, Kalathur, Lambard, Aït-Ali, Yang, Lardenois, Ripp, Poch, Zack, Sahel, Léveillard: "The homeobox gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina." in: Human molecular genetics, Vol. 19, Issue 2, pp. 250-61, 2009 (Pubmed)
  • Aprelikova, Wood, Tackett, Chandramouli, Barrett: "Role of ETS transcription factors in the hypoxia-inducible factor-2 target gene selection." in: Cancer research, Vol. 66, Issue 11, pp. 5641-7, 2006 (Pubmed)
Catalog No. ABIN3377880
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EXOC2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Exocyst Complex Component 2 (EXOC2)
NCBI Accession:
NM_018303,NP_060773
Species:
Human
Synonyms:
Sec5, EXOC2, Exoc2, SEC5A, sec-5
Insert length:
4700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Simicek, Lievens, Laga, Guzenko, Aushev, Kalev, Baietti, Strelkov, Gevaert, Tavernier, Sablina: "The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response." in: Nature cell biology, Vol. 15, Issue 10, pp. 1220-30, 2013 (Pubmed)
Catalog No. ABIN3377943
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human FABP1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Fatty Acid Binding Protein 1, Liver (FABP1)
NCBI Accession:
NM_001443,NP_001434
Species:
Human
Synonyms:
FABP1, Fabp1, fabp1a, LOC100726384
Insert length:
700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Rowland, Hallifax, Nussio, Shapter, Mackenzie, Brian Houston, Knights, Miners: "Characterization of the comparative drug binding to intra- (liver fatty acid binding protein) and extra- (human serum albumin) cellular proteins." in: Xenobiotica; the fate of foreign compounds in biological systems, Vol. 45, Issue 10, pp. 847-57, 2015 (Pubmed)
  • Martin, McIntosh, Huang, Gupta, Atshaves, Landrock, Landrock, Kier, Schroeder: "The human liver fatty acid binding protein T94A variant alters the structure, stability, and interaction with fibrates." in: Biochemistry, Vol. 52, Issue 51, pp. 9347-57, 2013 (Pubmed)
Catalog No. ABIN3377958
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human FES is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Feline Sarcoma Oncogene (FES)
NCBI Accession:
NM_002005,NP_001996
Species:
Human
Synonyms:
FES, Fes, fes
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ye, Kantonen, Henkels, Gomez-Cambronero: "A new signaling pathway (JAK-Fes-phospholipase D) that is enhanced in highly proliferative breast cancer cells." in: The Journal of biological chemistry, Vol. 288, Issue 14, pp. 9881-91, 2013 (Pubmed)
  • Loriaux, Levine, Tyner, Fröhling, Scholl, Stoffregen, Wernig, Erickson, Eide, Berger, Bernard, Griffin, Stone, Lee, Meyerson, Heinrich, Deininger, Gilliland, Druker: "High-throughput sequence analysis of the tyrosine kinome in acute myeloid leukemia." in: Blood, Vol. 111, Issue 9, pp. 4788-96, 2008 (Pubmed)
Catalog No. ABIN3378040
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GABPA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
GA Binding Protein Transcription Factor, alpha Subunit 60kDa (GABPA)
NCBI Accession:
NM_002040,NP_002031
Species:
Human
Synonyms:
gabpa.S, GABPA, gabpa, Gabpa, gabpa.L
Insert length:
4700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ikeda, Pak, Chavez, Ryan: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, 2015 (Pubmed)
Catalog No. ABIN3378131
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GALNS is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Galactosamine (N-Acetyl)-6-Sulfate Sulfatase (GALNS)
NCBI Accession:
NM_000512,NP_000503
Species:
Human
Synonyms:
GALNS, Galns, Celly_0425, galns.L, galns
Insert length:
2640 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bhattacharyya, Kotlo, Shukla, Danziger, Tobacman: "Distinct effects of N-acetylgalactosamine-4-sulfatase and galactose-6-sulfatase expression on chondroitin sulfates." in: The Journal of biological chemistry, Vol. 283, Issue 15, pp. 9523-30, 2008 (Pubmed)
  • Chen, Kuo, Li, Bui, Peake, Sanders, Thibodeaux, Chu, Qian, Zhao, Bredt, Moller, Konrad, Beigneux, Young, Cao: "AGPAT6 is a novel microsomal glycerol-3-phosphate acyltransferase." in: The Journal of biological chemistry, Vol. 283, Issue 15, pp. 10048-57, 2008 (Pubmed)
Catalog No. ABIN3378140
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...