You are viewing an incomplete version of our website. Please click to reload the website as full version.

Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,026,919 Products
Data Quality
  • 2026
Type
  • 1026919
    Plasmid
Gene
  • 1005
  • 295
  • 290
  • 253
  • 242
Species
  • 403783
  • 335493
  • 197298
  • 19989
  • 18117
Insert
  • 689356
  • 298383
  • 39144
  • 36
Vector
  • 779667
    Mammalian Expression Vector
  • 565441
  • 247252
    Bacterial Expression Vector
  • 161881
  • 87096
Vector Backbone
  • 108735
  • 62463
  • 62462
  • 62462
  • 62462
Fusion tag
  • 210145
  • 216580
  • 93600
  • 91626
  • 61225
Resistance Gene
  • 767689
  • 259230
Selectable Marker
  • 370009
  • 179829
  • 57
Promoter
  • 401035
  • 365923
  • 264117
  • 39145
  • 3184
Expression Type
  • 596642
  • 427081
  • 68536
  • 3174
  • 10
Application
  • 740488
  • 366221
  • 39144
  • 27
  • 26
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRIB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tribbles Homolog 1 (Drosophila)
NCBI Accession:
NM_025195, NP_079471
Species:
Human
Synonyms:
TRIB1, trib1, Trib1
Insert length:
3240 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Soubeyrand, Martinuk, Lau, McPherson: "TRIB1 Is Regulated Post-Transcriptionally by Proteasomal and Non-Proteasomal Pathways." in: PLoS ONE, Vol. 11, Issue 3, pp. e0152346, 2016 (Pubmed)
Catalog No. ABIN3387439
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TSG101 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tumor Susceptibility Gene 101
NCBI Accession:
NM_006292, NP_006283
Species:
Human
Synonyms:
TSG101, tsg-101, tsg101, Tsg101
Insert length:
1560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Gray, Alsamman, Murray, Sims, Hupp: "Engineering a synthetic cell panel to identify signalling components reprogrammed by the cell growth regulator anterior gradient-2." in: Molecular bioSystems, Vol. 10, Issue 6, pp. 1409-25, 2014 (Pubmed)
Catalog No. ABIN3387479
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Speckle-Type POZ Protein
NCBI Accession:
NM_003563, NP_003554
Species:
Human
Synonyms:
spop, SPOP, Bm1_45730, spop-b, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VAPB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
VAMP (Vesicle-Associated Membrane Protein)-Associated Protein B and C
NCBI Accession:
NM_004738, NP_004729
Species:
Human
Synonyms:
Tsp_07972, VAPB, LOC788595, LOC100350714, Vapb
Insert length:
2440 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Aliaga, Lai, Yu, Chub, Shim, Sun, Xie, Yang, Lin, ODonovan, Cai: "Amyotrophic lateral sclerosis-related VAPB P56S mutation differentially affects the function and survival of corticospinal and spinal motor neurons." in: Human molecular genetics, Vol. 22, Issue 21, pp. 4293-305, 2013 (Pubmed)
  • De Vos, Mórotz, Stoica, Tudor, Lau, Ackerley, Warley, Shaw, Miller: "VAPB interacts with the mitochondrial protein PTPIP51 to regulate calcium homeostasis." in: Human molecular genetics, Vol. 21, Issue 6, pp. 1299-311, 2012 (Pubmed)
Catalog No. ABIN3387670
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PEPD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Peptidase D
NCBI Accession:
NM_000285, NP_000276
Species:
Human
Synonyms:
pepd, pepD, PEPD, Pepd
Insert length:
1910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Li, Ding, Choi, Kazim, Zhang: "Prolidase directly binds and activates epidermal growth factor receptor and stimulates downstream signaling." in: The Journal of biological chemistry, Vol. 288, Issue 4, pp. 2365-75, 2013 (Pubmed)
Catalog No. ABIN3385756
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
Species:
Human
Synonyms:
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PINK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
PTEN Induced Putative Kinase 1
NCBI Accession:
NM_032409, NP_115785
Species:
Human
Synonyms:
Pink1, PINK1, pink1
Insert length:
2710 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Aerts, Craessaerts, De Strooper, Morais: "In Vitro Comparison of the Activity Requirements and Substrate Specificity of Human and Triboleum castaneum PINK1 Orthologues." in: PLoS ONE, Vol. 11, Issue 1, pp. e0146083, 2016 (Pubmed)
  • Aerts, Craessaerts, De Strooper, Morais: "PINK1 kinase catalytic activity is regulated by phosphorylation on serines 228 and 402." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2798-811, 2015 (Pubmed)
  • Gómez-Sánchez, Gegg, Bravo-San Pedro, Niso-Santano, Alvarez-Erviti, Pizarro-Estrella, Gutiérrez-Martín, Alvarez-Barrientos, Fuentes, González-Polo, Schapira: "Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression." in: Neurobiology of disease, Vol. 62, Issue , pp. 426-40, 2013 (Pubmed)
  • Zhou, Huang, Shao, May, Prou, Perier, Dauer, Schon, Przedborski: "The kinase domain of mitochondrial PINK1 faces the cytoplasm." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 33, pp. 12022-7, 2008 (Pubmed)
  • Sim, Lio, Mok, Masters, Hill, Culvenor, Cheng: "C-terminal truncation and Parkinson's disease-associated mutations down-regulate the protein serine/threonine kinase activity of PTEN-induced kinase-1." in: Human molecular genetics, Vol. 15, Issue 21, pp. 3251-62, 2006 (Pubmed)
  • Petit, Kawarai, Paitel, Sanjo, Maj, Scheid, Chen, Gu, Hasegawa, Salehi-Rad, Wang, Rogaeva, Fraser, Robinson, St George-Hyslop, Tandon: "Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations." in: The Journal of biological chemistry, Vol. 280, Issue 40, pp. 34025-32, 2005 (Pubmed)
  • Show more References
Catalog No. ABIN3385829
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
Species:
Human
Synonyms:
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PGRMC1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Progesterone Receptor Membrane Component 1
NCBI Accession:
NM_006667, NP_006658
Species:
Human
Synonyms:
pgrmc1, PGRMC1, Pgrmc1
Insert length:
1800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Thomas, Pang, Dong et al.: "Enhancement of cell surface expression and receptor functions of membrane progestin receptor α (mPRα) by progesterone receptor membrane component 1 (PGRMC1): evidence for a role of PGRMC1 as an ..." in: Endocrinology, Vol. 155, Issue 3, pp. 1107-19, 2014 (Pubmed)
Catalog No. ABIN3385781
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human POT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Protection of Telomeres 1 Homolog (S. Pombe)
NCBI Accession:
NM_015450, NP_056265
Species:
Human
Synonyms:
POT1, Pot1, Pot1a
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Robles-Espinoza, Harland, Ramsay, Aoude, Quesada, Ding, Pooley, Pritchard, Tiffen, Petljak, Palmer, Symmons, Johansson, Stark, Gartside, Snowden, Montgomery, Martin, Liu, Choi, Makowski, Brown et al.: "POT1 loss-of-function variants predispose to familial melanoma. ..." in: Nature genetics, Vol. 46, Issue 5, pp. 478-81, 2014 (Pubmed)
Catalog No. ABIN3385950
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDUFV1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
NADH Dehydrogenase (Ubiquinone) Flavoprotein 1, 51kDa
NCBI Accession:
NM_007103, NP_009034
Species:
Human
Synonyms:
Ndufv1, NDUFV1, ndufv1
Insert length:
1570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jacquemin, Margiotta, Kasahara, Bassoy, Walch, Thiery, Lieberman, Martinvalet: "Granzyme B-induced mitochondrial ROS are required for apoptosis." in: Cell death and differentiation, Vol. 22, Issue 5, pp. 862-74, 2015 (Pubmed)
Catalog No. ABIN3385404
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PPM1K is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Protein Phosphatase, Mg2+/Mn2+ Dependent, 1K
NCBI Accession:
NM_152542, NP_689755
Species:
Human
Synonyms:
Ppm1k, ppm1k, PPM1K
Insert length:
2250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Marion, Urs, Peterson, Sotnikova, Beaulieu, Gainetdinov, Caron: "Dopamine D2 receptor relies upon PPM/PP2C protein phosphatases to dephosphorylate huntingtin protein." in: The Journal of biological chemistry, Vol. 289, Issue 17, pp. 11715-24, 2014 (Pubmed)
Catalog No. ABIN3385980
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NFYA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nuclear Transcription Factor Y, alpha
NCBI Accession:
NM_021705, NP_068351
Species:
Human
Synonyms:
nfya, NFYA, Nfya
Insert length:
3570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Morachis, Murawsky, Emerson: "Regulation of the p53 transcriptional response by structurally diverse core promoters." in: Genes & development, Vol. 24, Issue 2, pp. 135-47, 2010 (Pubmed)
  • Chia, Leung, Krushel, Alajez, Lo, Busson, Klamut, Bastianutto, Liu: "Nuclear factor-Y and Epstein Barr virus in nasopharyngeal cancer." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 4, pp. 984-94, 2008 (Pubmed)
Catalog No. ABIN3385438
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PPT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Palmitoyl-Protein Thioesterase 1
NCBI Accession:
NM_000310, NP_000301
Species:
Human
Synonyms:
MGYG_00692, PPT1, Ppt1, ppt-1, RGD1560700
Insert length:
2610 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Mamo, Jules, Dumaresq-Doiron, Costantino, Lefrancois: "The role of ceroid lipofuscinosis neuronal protein 5 (CLN5) in endosomal sorting." in: Molecular and cellular biology, Vol. 32, Issue 10, pp. 1855-66, 2012 (Pubmed)
Catalog No. ABIN3386017
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NMT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
N-Myristoyltransferase 1
NCBI Accession:
NM_021079, NP_066565
Species:
Human
Synonyms:
nmt2, nmt1, SPBC2G2.11, NMT1, Nmt1, nmt1a
Insert length:
1870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kumar, Sharma: "An improved method and cost effective strategy for soluble expression and purification of human N-myristoyltransferase 1 in E. coli." in: Molecular and cellular biochemistry, Vol. 392, Issue 1-2, pp. 175-86, 2014 (Pubmed)
Catalog No. ABIN3385469
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PRMT5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Protein Arginine Methyltransferase 5
NCBI Accession:
NM_006109, NP_006100
Species:
Human
Synonyms:
PRMT5, prmt5, Prmt5, Hrmt1l5, prmt-5
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Wang, Ren, Jin, Wang, Sun, Diao, Wang, Mi: "Proliferative role of TRAF4 in breast cancer by upregulating PRMT5 nuclear expression." in: Tumour biology, Vol. 36, Issue 8, pp. 5901-11, 2015 (Pubmed)
  • Ratovitski, Arbez, Stewart, Chighladze, Ross: "PRMT5- mediated symmetric arginine dimethylation is attenuated by mutant huntingtin and is impaired in Huntington's disease (HD)." in: Cell cycle (Georgetown, Tex.), Vol. 14, Issue 11, pp. 1716-29, 2015 (Pubmed)
Catalog No. ABIN3386054
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human MMP14 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Matrix Metallopeptidase 14 (Membrane-inserted)
NCBI Accession:
NM_004995, NP_004986
Species:
Human
Synonyms:
mmp14, MMP14, Mmp14
Insert length:
3500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,SP6 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Stratman, Saunders, Sacharidou, Koh, Fisher, Zawieja, Davis, Davis: "Endothelial cell lumen and vascular guidance tunnel formation requires MT1-MMP-dependent proteolysis in 3-dimensional collagen matrices." in: Blood, Vol. 114, Issue 2, pp. 237-47, 2009 (Pubmed)
  • Nacu, Luzina, Highsmith, Lockatell, Pochetuhen, Cooper, Gillmeister, Todd, Atamas: "Macrophages produce TGF-beta-induced (beta-ig-h3) following ingestion of apoptotic cells and regulate MMP14 levels and collagen turnover in fibroblasts." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 7, pp. 5036-44, 2008 (Pubmed)
Catalog No. ABIN3393641
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PI4K2A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Phosphatidylinositol 4-Kinase Type 2 alpha
NCBI Accession:
NM_018425, NP_060895
Species:
Human
Synonyms:
PI4K2A, pi4k2a, Pi4k2a
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,SP6 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moorhead, Jung, Smirnov, Kaufer, Scidmore: "Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion." in: Infection and immunity, Vol. 78, Issue 5, pp. 1990-2007, 2010 (Pubmed)
Catalog No. ABIN3393695
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KPNA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Karyopherin alpha 2 (RAG Cohort 1, Importin alpha 1)
NCBI Accession:
NM_002266, NP_002257
Species:
Human
Synonyms:
EDI_246290, EDI_335040, ima2, kpna2, Kpna2, KPNA2, Kpna7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Zhao, Bi, Sun, Liu, Liu: "Tyrosine 132 phosphorylation of influenza A virus M1 protein is crucial for virus replication by controlling the nuclear import of M1." in: Journal of virology, Vol. 87, Issue 11, pp. 6182-91, 2013 (Pubmed)
Catalog No. ABIN3319028
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LRG1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leucine-Rich alpha-2 Glycoprotein 1
NCBI Accession:
NM_052972, NP_443204
Species:
Human
Synonyms:
si:dkey-90m5.4, LRG1, lrg1, Lrg1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Guergova-Kuras, Kurucz, Hempel, Tardieu, Kádas, Malderez-Bloes, Jullien, Kieffer, Hincapie, Guttman, Csánky, Dezso, Karger, Takács: "Discovery of lung cancer biomarkers by profiling the plasma proteome with monoclonal antibody libraries." in: Molecular & cellular proteomics : MCP, Vol. 10, Issue 12, pp. M111.010298, 2011 (Pubmed)
Catalog No. ABIN3319052
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...