You are viewing an incomplete version of our website. Please click to reload the website as full version.

Search Results

Data Quality
  • 3404
Type
  • 503066
  • 55760
  • 1
Gene
  • 331
  • 163
  • 153
  • 146
  • 145
Species
  • 283902
  • 145130
  • 129606
  • 176
Application
  • 271609
  • 248061
  • 39144
  • 12
  • 12
Fusion tag
  • 185504
  • 183643
  • 135728
  • 53952
Vector Backbone
  • 108735
  • 53976
  • 53972
  • 53953
  • 53952
Vector
  • 203234
  • 161881
  • 137951
Insert
  • 215849
  • 172292
  • 75769
  • 39144
  • 12
Oligo-Type
  • 55760
Resistance Gene
  • 191903
  • 162688
  • 148475
Expression Type
  • 503065
  • 253786
  • 1
Selectable Marker
  • 215853
  • 92248
Promoter
  • 254998
  • 172292
  • 114921
  • 16865
  • 804
Next filter by Product Type
    • 503066
    • 55760
    • 1
558,827 Products
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt3a is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 3A
NCBI Accession:
NM_009522, NP_033548
Species:
Mouse (Murine)
Synonyms:
WNT3A, Wnt3a, wnt3a
Insert length:
1059 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Parr, Mirzaei, Christian, Sastre: "Activation of the Wnt/β-catenin pathway represses the transcription of the β-amyloid precursor protein cleaving enzyme (BACE1) via binding of T-cell factor-4 to BACE1 promoter." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 29, Issue 2, pp. 623-35, 2015 (Pubmed)
Catalog No. ABIN3376391
$390.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Stat3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor)
NCBI Accession:
NP_035616
Species:
Mouse (Murine)
Synonyms:
STAT3, stat3, Stat3, stat3.1
Insert length:
2169 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Elsarraj, Hong, Valdez, Carletti, Salah, Raimo, Taverna, Prochasson, Bharadwaj, Tweardy, Christenson, Behbod: "A novel role of microRNA146b in promoting mammary alveolar progenitor cell maintenance." in: Journal of cell science, Vol. 126, Issue Pt 11, pp. 2446-58, 2013 (Pubmed)
Catalog No. ABIN3372380
$900.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Stat3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor)
NCBI Accession:
NP_998824
Species:
Mouse (Murine)
Synonyms:
STAT3, stat3, Stat3, stat3.1
Insert length:
2313 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kabra, Pfuhlmann, García-Cáceres, Schriever, Casquero García, Kebede, Fuente-Martin, Trivedi, Heppner, Uhlenhaut, Legutko, Kabra, Gao, Yi, Quarta, Clemmensen, Finan, Müller, Meyer, Paez-Pereda et al.: "Hypothalamic leptin action is mediated by histone deacetylase 5. ..." in: Nature communications, Vol. 7, Issue , pp. 10782, 2016 (Pubmed)
  • Elsarraj, Hong, Valdez, Carletti, Salah, Raimo, Taverna, Prochasson, Bharadwaj, Tweardy, Christenson, Behbod: "A novel role of microRNA146b in promoting mammary alveolar progenitor cell maintenance." in: Journal of cell science, Vol. 126, Issue Pt 11, pp. 2446-58, 2013 (Pubmed)
Catalog No. ABIN3372382
$960.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRIB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tribbles Homolog 1 (Drosophila)
NCBI Accession:
NM_025195, NP_079471
Species:
Human
Synonyms:
TRIB1, trib1, Trib1
Insert length:
3240 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Soubeyrand, Martinuk, Lau, McPherson: "TRIB1 Is Regulated Post-Transcriptionally by Proteasomal and Non-Proteasomal Pathways." in: PLoS ONE, Vol. 11, Issue 3, pp. e0152346, 2016 (Pubmed)
Catalog No. ABIN3387439
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRIB3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tribbles Homolog 3 (Drosophila)
NCBI Accession:
NM_021158, NP_066981
Species:
Human
Synonyms:
trib3, TRIB3, Trib3
Insert length:
2210 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Izrailit, Jaiswal, Zheng, Moran, Reedijk: "Cellular stress induces TRB3/USP9x-dependent Notch activation in cancer." in: Oncogene, Vol. , Issue , pp. , 2016 (Pubmed)
  • Izrailit, Berman, Datti, Wrana, Reedijk: "High throughput kinase inhibitor screens reveal TRB3 and MAPK-ERK/TGFβ pathways as fundamental Notch regulators in breast cancer." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 5, pp. 1714-9, 2013 (Pubmed)
  • Chan, Hilyard, Wu, Davis, Hill, Lal, Lieberman, Lagna, Hata: "Molecular basis for antagonism between PDGF and the TGFbeta family of signalling pathways by control of miR-24 expression." in: The EMBO journal, Vol. 29, Issue 3, pp. 559-73, 2010 (Pubmed)
Catalog No. ABIN3387440
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRIM37 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tripartite Motif Containing 37
NCBI Accession:
NM_015294, NP_056109
Species:
Human
Synonyms:
Trim37, TRIM37
Insert length:
3800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bhatnagar, Gazin, Chamberlain, Ou, Zhu, Tushir, Virbasius, Lin, Zhu, Wajapeyee, Green: "TRIM37 is a new histone H2A ubiquitin ligase and breast cancer oncoprotein." in: Nature, Vol. 516, Issue 7529, pp. 116-20, 2014 (Pubmed)
Catalog No. ABIN3387451
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TSG101 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tumor Susceptibility Gene 101
NCBI Accession:
NM_006292, NP_006283
Species:
Human
Synonyms:
TSG101, tsg-101, tsg101, Tsg101
Insert length:
1560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Gray, Alsamman, Murray, Sims, Hupp: "Engineering a synthetic cell panel to identify signalling components reprogrammed by the cell growth regulator anterior gradient-2." in: Molecular bioSystems, Vol. 10, Issue 6, pp. 1409-25, 2014 (Pubmed)
Catalog No. ABIN3387479
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPDEF is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Proximal Sequence Element 1
NCBI Accession:
NM_012391, NP_036523
Species:
Human
Synonyms:
SPDEF, Spdef
Insert length:
2100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Workman, Eudy, Smith, da Silva, Sinani, Bricker, Cook, Doster, Jones: "Cellular transcription factors induced in trigeminal ganglia during dexamethasone-induced reactivation from latency stimulate bovine herpesvirus 1 productive infection and certain viral promoters." in: Journal of virology, Vol. 86, Issue 5, pp. 2459-73, 2012 (Pubmed)
Catalog No. ABIN3386930
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Speckle-Type POZ Protein
NCBI Accession:
NM_003563, NP_003554
Species:
Human
Synonyms:
spop, SPOP, Bm1_45730, spop-b, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human STK3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
serine/threonine Kinase 3
NCBI Accession:
NM_006281, NP_006272
Species:
Human
Synonyms:
STK3, Stk3, stk3
Insert length:
2730 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chan, Lim, Guo, Tan, Leung, Hong: "Actin-binding and cell proliferation activities of angiomotin family members are regulated by Hippo pathway-mediated phosphorylation." in: The Journal of biological chemistry, Vol. 288, Issue 52, pp. 37296-307, 2013 (Pubmed)
Catalog No. ABIN3387029
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VAPB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
VAMP (Vesicle-Associated Membrane Protein)-Associated Protein B and C
NCBI Accession:
NM_004738, NP_004729
Species:
Human
Synonyms:
Tsp_07972, VAPB, LOC788595, LOC100350714, Vapb
Insert length:
2440 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Aliaga, Lai, Yu, Chub, Shim, Sun, Xie, Yang, Lin, ODonovan, Cai: "Amyotrophic lateral sclerosis-related VAPB P56S mutation differentially affects the function and survival of corticospinal and spinal motor neurons." in: Human molecular genetics, Vol. 22, Issue 21, pp. 4293-305, 2013 (Pubmed)
  • De Vos, Mórotz, Stoica, Tudor, Lau, Ackerley, Warley, Shaw, Miller: "VAPB interacts with the mitochondrial protein PTPIP51 to regulate calcium homeostasis." in: Human molecular genetics, Vol. 21, Issue 6, pp. 1299-311, 2012 (Pubmed)
Catalog No. ABIN3387670
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PARP12 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Poly (ADP-Ribose) Polymerase Family, Member 12
NCBI Accession:
NM_022750, NP_073587
Species:
Human
Synonyms:
PARP12, parp12, parp12a, Parp12
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • MacPherson, Ahmed, Tamblyn, Krutmann, Förster, Weighardt, Matthews: "Aryl hydrocarbon receptor repressor and TiPARP (ARTD14) use similar, but also distinct mechanisms to repress aryl hydrocarbon receptor signaling." in: International journal of molecular sciences, Vol. 15, Issue 5, pp. 7939-57, 2014 (Pubmed)
  • MacPherson, Tamblyn, Rajendra, Bralha, McPherson, Matthews: "2,3,7,8-Tetrachlorodibenzo-p-dioxin poly(ADP-ribose) polymerase (TiPARP, ARTD14) is a mono-ADP-ribosyltransferase and repressor of aryl hydrocarbon receptor transactivation." in: Nucleic acids research, Vol. 41, Issue 3, pp. 1604-21, 2013 (Pubmed)
Catalog No. ABIN3385679
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PDCD4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Programmed Cell Death 4 (Neoplastic Transformation Inhibitor)
NCBI Accession:
NM_014456, NP_055271
Species:
Human
Synonyms:
pdcd4, PDCD4, Pdcd4
Insert length:
2640 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Pisano, Ceglia, Palmieri, Vecchio, Fiume, de Laurentiis, Mimmi, Falcone, Iaccino, Scialdone, Pontoriero, Masci, Valea, Krishnan, Gaspari, Cuda, Scala, Quinto: "CRL3IBTK Regulates the Tumor Suppressor Pdcd4 through Ubiquitylation Coupled to Proteasomal Degradation." in: The Journal of biological chemistry, Vol. 290, Issue 22, pp. 13958-71, 2015 (Pubmed)
Catalog No. ABIN3385720
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PEPD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Peptidase D
NCBI Accession:
NM_000285, NP_000276
Species:
Human
Synonyms:
pepd, pepD, PEPD, Pepd
Insert length:
1910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Li, Ding, Choi, Kazim, Zhang: "Prolidase directly binds and activates epidermal growth factor receptor and stimulates downstream signaling." in: The Journal of biological chemistry, Vol. 288, Issue 4, pp. 2365-75, 2013 (Pubmed)
Catalog No. ABIN3385756
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RNF139 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 139
NCBI Accession:
NM_007218, NP_009149
Species:
Human
Synonyms:
RNF139, Rnf139
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Lan, Chau: "TRC8 suppresses tumorigenesis through targeting heme oxygenase-1 for ubiquitination and degradation." in: Oncogene, Vol. 32, Issue 18, pp. 2325-34, 2013 (Pubmed)
Catalog No. ABIN3386406
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PINK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
PTEN Induced Putative Kinase 1
NCBI Accession:
NM_032409, NP_115785
Species:
Human
Synonyms:
Pink1, PINK1, pink1
Insert length:
2710 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Aerts, Craessaerts, De Strooper, Morais: "In Vitro Comparison of the Activity Requirements and Substrate Specificity of Human and Triboleum castaneum PINK1 Orthologues." in: PLoS ONE, Vol. 11, Issue 1, pp. e0146083, 2016 (Pubmed)
  • Aerts, Craessaerts, De Strooper, Morais: "PINK1 kinase catalytic activity is regulated by phosphorylation on serines 228 and 402." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2798-811, 2015 (Pubmed)
  • Gómez-Sánchez, Gegg, Bravo-San Pedro, Niso-Santano, Alvarez-Erviti, Pizarro-Estrella, Gutiérrez-Martín, Alvarez-Barrientos, Fuentes, González-Polo, Schapira: "Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression." in: Neurobiology of disease, Vol. 62, Issue , pp. 426-40, 2013 (Pubmed)
  • Zhou, Huang, Shao, May, Prou, Perier, Dauer, Schon, Przedborski: "The kinase domain of mitochondrial PINK1 faces the cytoplasm." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 105, Issue 33, pp. 12022-7, 2008 (Pubmed)
  • Sim, Lio, Mok, Masters, Hill, Culvenor, Cheng: "C-terminal truncation and Parkinson's disease-associated mutations down-regulate the protein serine/threonine kinase activity of PTEN-induced kinase-1." in: Human molecular genetics, Vol. 15, Issue 21, pp. 3251-62, 2006 (Pubmed)
  • Petit, Kawarai, Paitel, Sanjo, Maj, Scheid, Chen, Gu, Hasegawa, Salehi-Rad, Wang, Rogaeva, Fraser, Robinson, St George-Hyslop, Tandon: "Wild-type PINK1 prevents basal and induced neuronal apoptosis, a protective effect abrogated by Parkinson disease-related mutations." in: The Journal of biological chemistry, Vol. 280, Issue 40, pp. 34025-32, 2005 (Pubmed)
  • Show more References
Catalog No. ABIN3385829
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RPE65 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Retinal Pigment Epithelium-Specific Protein 65kDa
NCBI Accession:
NM_000329, NP_000320
Species:
Human
Synonyms:
rpe65c, LOC100219959, LOC100352270, Rpe65, RPE65
Insert length:
2780 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bavik, Henry, Zhang, Mitts, McGinn, Budzynski, Pashko, Lieu, Zhong, Blumberg, Kuksa, Orme, Scott, Fawzi, Kubota: "Visual Cycle Modulation as an Approach toward Preservation of Retinal Integrity." in: PLoS ONE, Vol. 10, Issue 5, pp. e0124940, 2015 (Pubmed)
Catalog No. ABIN3386437
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PGRMC1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Progesterone Receptor Membrane Component 1
NCBI Accession:
NM_006667, NP_006658
Species:
Human
Synonyms:
pgrmc1, PGRMC1, Pgrmc1
Insert length:
1800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Thomas, Pang, Dong et al.: "Enhancement of cell surface expression and receptor functions of membrane progestin receptor α (mPRα) by progesterone receptor membrane component 1 (PGRMC1): evidence for a role of PGRMC1 as an ..." in: Endocrinology, Vol. 155, Issue 3, pp. 1107-19, 2014 (Pubmed)
Catalog No. ABIN3385781
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human POT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Protection of Telomeres 1 Homolog (S. Pombe)
NCBI Accession:
NM_015450, NP_056265
Species:
Human
Synonyms:
POT1, Pot1, Pot1a
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Robles-Espinoza, Harland, Ramsay, Aoude, Quesada, Ding, Pooley, Pritchard, Tiffen, Petljak, Palmer, Symmons, Johansson, Stark, Gartside, Snowden, Montgomery, Martin, Liu, Choi, Makowski, Brown et al.: "POT1 loss-of-function variants predispose to familial melanoma. ..." in: Nature genetics, Vol. 46, Issue 5, pp. 478-81, 2014 (Pubmed)
Catalog No. ABIN3385950
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDUFV1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
NADH Dehydrogenase (Ubiquinone) Flavoprotein 1, 51kDa
NCBI Accession:
NM_007103, NP_009034
Species:
Human
Synonyms:
Ndufv1, NDUFV1, ndufv1
Insert length:
1570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter,T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jacquemin, Margiotta, Kasahara, Bassoy, Walch, Thiery, Lieberman, Martinvalet: "Granzyme B-induced mitochondrial ROS are required for apoptosis." in: Cell death and differentiation, Vol. 22, Issue 5, pp. 862-74, 2015 (Pubmed)
Catalog No. ABIN3385404
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...