Acidic Calponin 3 (Calponin 3, Acidic, CNN3)

Short Description: This gene encodes a protein with a markedly acidic C terminus\; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008].
More information related to gene Acidic Calponin 3.
Products related to Acidic Calponin 3 Gene:
150 Products
  • 142
  • 8
  • 61
  • 45
  • 30
  • 6
  • 4
  • 97
  • 38
  • 27
  • 16
  • 2
Fusion tag
  • 59
  • 16
  • 13
  • 12
  • 8
Vector Backbone
  • 8
  • 7
  • 6
  • 6
  • 6
  • 74
  • 36
  • 12
  • 9
  • 6
  • 54
  • 51
  • 21
  • 8
  • 6
  • 6
  • 2
Resistance Gene
  • 64
  • 53
  • 20
  • 5
  • 2
Expression Type
  • 108
  • 52
  • 26
Selectable Marker
  • 29
  • 26
  • 26
  • 1
  • 48
  • 35
  • 31
  • 13
  • 8
  • 73
  • 28
  • 27
  • 22
Supplier: Log in to see

Calponin 3, Acidic (CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5720722
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
Calponin 3, Acidic (CNN3)
NCBI Accession:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5337681
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4073236
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4073237
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see
ISO 9001:2008

Protein Expression
Calponin 3, Acidic (CNN3)
NCBI Accession:
Gene ID:
1266 (Human, CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4940467
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
326931 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877109
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Calponin 3, Acidic (CNN3)
Gene ID:
1266 (Human, CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083790
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
54321 (Rat (Rattus), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879281
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
394869 (Xenopus tropicalis, CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3882062
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
394869 (Xenopus tropicalis, CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3882064
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
538975 (Cow (Bovine), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3863580
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
380174 (Xenopus laevis, CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3843815
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
71994 (Mouse (Murine), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3824259
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Calponin 3, Acidic (CNN3)
NCBI Accession:
Rat (Rattus)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3886618
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Calponin 3, Acidic (CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3558692
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Calponin 3, Acidic
1600014M03Rik, C85854, Calpo3, MGC76140, CNN3, cnn3, MGC53115, wu:fe49h10, zgc:64211, hm:zehn1486, wu:fa99a06, zgc:112050, zgc:123208
-20 °C
Catalog No. ABIN3192270
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Calponin 3, Acidic
Rat (Rattus)
1600014M03Rik, C85854, Calpo3, MGC76140, CNN3, cnn3, MGC53115, wu:fe49h10, zgc:64211, hm:zehn1486, wu:fa99a06, zgc:112050, zgc:123208
-20 °C
Catalog No. ABIN3197141
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4073238
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4073239
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Calponin 3, Acidic (CNN3)
Gene ID:
326931 (Zebrafish (Danio rerio), CNN3)
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3840791
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Acidic Calponin 3

  • calponin 3 (CNN3)
  • calponin 3, acidic (Cnn3)
  • calponin 3, acidic (cnn3)
  • calponin 3, acidic L homeolog (cnn3.L)
  • Calponin-3 (cnn3)
  • calponin 3 (Cnn3)
  • calponin 3, acidic a (cnn3a)
  • calponin 3, acidic b (cnn3b)
  • 1600014M03Rik
  • C85854
  • Calpo3
  • CNN3
  • cnn3
  • hm:zehn1486
  • MGC53115
  • MGC76140
  • wu:fa99a06
  • wu:fe49h10
  • zgc:64211
  • zgc:112050
  • zgc:123208

Gene-IDs for different species

1266 Homo sapiens
71994 Mus musculus
394869 Xenopus (Silurana) tropicalis
424485 Gallus gallus
479937 Canis lupus familiaris
538975 Bos taurus
100049656 Sus scrofa
100409631 Callithrix jacchus
380174 Xenopus laevis
100445628 Pongo abelii
100599432 Nomascus leucogenys
100194836 Salmo salar
54321 Rattus norvegicus
326931 Danio rerio
100726520 Cavia porcellus
337142 Danio rerio
100358440 Oryctolagus cuniculus

Protein level used designations for Acidic Calponin 3

  • calponin, acidic isoform
  • calponin-3
  • dJ639P13.2.2 (acidic calponin 3)
  • calponin 3, acidic
  • calponin-3-like
  • Calponin-3
  • acidic calponin h3
  • calponin, non-muscle isoform
  • calponin 3, acidic b
  • zehn1486
Other products related to Acidic Calponin 3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website