Acidic Calponin 3 (Calponin 3, Acidic, CNN3)

Short Description: This gene encodes a protein with a markedly acidic C terminus\; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008].
More information related to gene Acidic Calponin 3.
Products related to Acidic Calponin 3 Gene:
150 Products
Type
  • 142
  • 8
Species
  • 61
  • 45
  • 30
  • 6
  • 4
Oligo-Type
  • 6
  • 2
Insert
  • 54
  • 51
  • 21
  • 8
  • 6
Vector
  • 74
  • 36
  • 12
  • 9
  • 6
Vector Backbone
  • 8
  • 7
  • 6
  • 6
  • 6
Fusion tag
  • 59
  • 16
  • 13
  • 12
  • 8
Resistance Gene
  • 64
  • 53
  • 20
  • 5
  • 2
Selectable Marker
  • 29
  • 26
  • 26
  • 1
Promoter
  • 48
  • 35
  • 31
  • 13
  • 8
Expression Type
  • 108
  • 52
  • 26
Application
  • 97
  • 38
  • 27
  • 16
  • 2
Format
  • 73
  • 28
  • 27
  • 22
Supplier: Log in to see

ORF Cloning-Vector holds the gene between an AflII and EcoRV cut site.

Type:
ORF
Application:
Cloning
Gene:
Calponin 3, Acidic (CNN3)
Species:
Human
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720722
$45.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens calponin 3, acidic.

Type:
cDNA
Application:
Cloning
Gene:
Calponin 3, Acidic (CNN3)
Species:
Human
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558692
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Rattus norvegicus calponin 3

Type:
cDNA
Application:
Cloning
Gene:
Calponin 3, Acidic (CNN3)
NCBI Accession:
NM_019359
Species:
Rat (Rattus)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3886618
$75.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Calponin 3, Acidic
Species:
Rat (Rattus)
Synonyms:
1600014M03Rik, C85854, Calpo3, MGC76140, CNN3, cnn3, MGC53115, wu:fe49h10, zgc:64211, hm:zehn1486, wu:fa99a06, zgc:112050, zgc:123208
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197141
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Verified forward and reverse primers for analyzing the quantitative expression of gene

Application:
Quantitative real-time PCR
Gene:
Calponin 3, Acidic
Species:
Human
Synonyms:
1600014M03Rik, C85854, Calpo3, MGC76140, CNN3, cnn3, MGC53115, wu:fe49h10, zgc:64211, hm:zehn1486, wu:fa99a06, zgc:112050, zgc:123208
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192270
$79.00
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human calponin 3, acidic (CNN3)

Type:
ORF
Application:
Protein Expression
Gene:
Calponin 3, Acidic (CNN3)
NCBI Accession:
NM_001839,NP_001830
Species:
Human
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337681
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Expression/transfection ready cDNA ORF clone of Human CNN3 with C terminal DYKDDDDK tag is ideal for express proteins in E.coli & mammalian cells.

Type:
ORF
Application:
Protein Expression
Gene:
Calponin 3, Acidic (CNN3)
NCBI Accession:
NM_001839
Gene ID:
1266 (Human, CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Insert length:
990 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4940467
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Full length Danio rerio calponin 3, acidic b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073237
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Danio rerio calponin 3, acidic a cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
326931 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877109
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Danio rerio calponin 3, acidic b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073236
$99.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
71994 (Mouse (Murine), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824259
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
538975 (Cow (Bovine), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863580
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Rattus norvegicus calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
54321 (Rat (Rattus), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879281
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
394869 (Xenopus tropicalis, CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882062
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus tropicalis calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
394869 (Xenopus tropicalis, CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882064
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
1266 (Human, CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083790
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Xenopus laevis calponin 3, acidic cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
380174 (Xenopus laevis, CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843815
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio calponin 3, acidic b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073238
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio calponin 3, acidic b cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
337142 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073239
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Danio rerio calponin 3, acidic a cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Calponin 3, Acidic (CNN3)
Gene ID:
326931 (Zebrafish (Danio rerio), CNN3)
Synonyms:
CNN3, Cnn3, cnn3, cnn3.L, cnn3a, cnn3b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840791
$139.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Acidic Calponin 3

  • calponin 3 (CNN3)
  • calponin 3, acidic (Cnn3)
  • calponin 3, acidic (cnn3)
  • calponin 3, acidic L homeolog (cnn3.L)
  • Calponin-3 (cnn3)
  • calponin 3 (Cnn3)
  • calponin 3, acidic a (cnn3a)
  • calponin 3, acidic b (cnn3b)
  • 1600014M03Rik
  • C85854
  • Calpo3
  • CNN3
  • cnn3
  • hm:zehn1486
  • MGC53115
  • MGC76140
  • wu:fa99a06
  • wu:fe49h10
  • zgc:64211
  • zgc:112050
  • zgc:123208

Gene-IDs for different species

GENE IDSPECIES
1266 Homo sapiens
71994 Mus musculus
394869 Xenopus (Silurana) tropicalis
424485 Gallus gallus
479937 Canis lupus familiaris
538975 Bos taurus
100049656 Sus scrofa
100409631 Callithrix jacchus
380174 Xenopus laevis
100445628 Pongo abelii
100599432 Nomascus leucogenys
100194836 Salmo salar
54321 Rattus norvegicus
326931 Danio rerio
100726520 Cavia porcellus
337142 Danio rerio
100358440 Oryctolagus cuniculus

Protein level used designations for Acidic Calponin 3

  • calponin, acidic isoform
  • calponin-3
  • dJ639P13.2.2 (acidic calponin 3)
  • calponin 3, acidic
  • calponin-3-like
  • Calponin-3
  • acidic calponin h3
  • calponin, non-muscle isoform
  • calponin 3, acidic b
  • zehn1486
Other products related to Acidic Calponin 3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com