CSF1 (Colony Stimulating Factor 1 (Macrophage), CSF1)

Short Description: The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011].
More information related to gene CSF1.
Products related to CSF1 Gene:
180 Products
Data Quality
  • 1
Type
  • 175
  • 5
Species
  • 74
  • 62
  • 28
  • 12
  • 4
Application
  • 121
  • 43
  • 24
  • 16
  • 1
Fusion tag
  • 54
  • 28
  • 23
  • 19
  • 9
Vector Backbone
  • 16
  • 16
  • 9
  • 6
  • 6
Vector
  • 75
  • 56
  • 20
  • 11
  • 9
Insert
  • 74
  • 65
  • 20
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 74
  • 54
  • 40
  • 7
  • 2
Expression Type
  • 147
  • 63
  • 22
Selectable Marker
  • 40
  • 26
  • 22
  • 1
Promoter
  • 66
  • 42
  • 30
  • 24
  • 8
Format
  • 82
  • 45
  • 32
  • 21

Type:
ORF
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Species:
Human
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Insert length:
1665 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741106
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
NCBI Accession:
NM_172211,NP_757350
Species:
Human
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Insert length:
771 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403542
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
790931 (Zebrafish (Danio rerio), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878449
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
1435 (Human, CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098045
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
100004617 (Zebrafish (Danio rerio), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070259
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808194
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
78965 (Rat (Rattus), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047195
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
1435 (Human, CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083875
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096436
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096437
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
NCBI Accession:
XM_001090841
Species:
Rhesus Monkey
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3558899
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
NCBI Accession:
NM_172212
Species:
Human
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104266
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Colony Stimulating Factor 1 (Macrophage)
Species:
Human
Synonyms:
CSF-1, MCSF, C87615, Csfm, op, csf1-1, zgc:172186, CSF1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190904
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
790931 (Zebrafish (Danio rerio), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3871453
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
100004617 (Zebrafish (Danio rerio), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4070258
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808195
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
78965 (Rat (Rattus), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4047194
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
1435 (Human, CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083876
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096438
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Gene ID:
12977 (Mouse (Murine), CSF1)
Synonyms:
CSF1, Csf1, csf1a, LOC396599, LOC100860895
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096439
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to CSF1

  • colony stimulating factor 1 (CSF1)
  • colony stimulating factor 1 (Csf1)
  • colony stimulating factor 1 (macrophage) (Csf1)
  • colony stimulating factor 1a (macrophage) (csf1a)
  • macrophage colony-stimulating factor 1 (LOC396599)
  • macrophage colony stimulating factor (LOC100860895)
  • C87615
  • CSF-1
  • CSF1
  • csf1-1
  • Csfm
  • MCSF
  • op
  • zgc:172186

Gene-IDs for different species

GENE IDSPECIES
1435 Homo sapiens
78965 Rattus norvegicus
12977 Mus musculus
100004617 Danio rerio
702532 Macaca mulatta
281094 Bos taurus
457127 Pan troglodytes
611795 Canis lupus familiaris
100452144 Pongo abelii
100499187 Taeniopygia guttata
100732898 Cavia porcellus
396599 Sus scrofa
100860895 Capra hircus
100499189 Gallus gallus

Protein level used designations for CSF1

  • lanimostim
  • macrophage colony-stimulating factor 1
  • CSF-1
  • MCSF
  • osteopetrosis
  • mcsf1
  • colony stimulating factor 1 (macrophage)
  • macrophage colony-stimulating factor 1-like
  • colony-stimulating factor 1
Other products related to CSF1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com