F2R (Coagulation Factor II (thrombin) Receptor, F2R)

Short Description: Coagulation factor II receptor is a 7-transmembrane receptor involved in the regulation of thrombotic response. Proteolytic cleavage leads to the activation of the receptor. F2R is a G-protein coupled receptor family member. [provided by RefSeq, Jul 2008].
More information related to gene F2R.
Products related to F2R Gene:
130 Products
Type
  • 124
  • 6
Species
  • 56
  • 41
  • 29
  • 2
  • 2
Application
  • 77
  • 31
  • 25
  • 16
  • 1
Fusion tag
  • 47
  • 15
  • 13
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 53
  • 36
  • 12
  • 9
  • 9
Insert
  • 47
  • 41
  • 20
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 54
  • 45
  • 20
  • 5
  • 2
Expression Type
  • 91
  • 50
  • 22
Selectable Marker
  • 26
  • 26
  • 22
  • 1
Promoter
  • 35
  • 31
  • 30
  • 13
  • 8
Format
  • 61
  • 27
  • 22
  • 20

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
14062 (Mouse (Murine), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808599
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
526585 (Cow (Bovine), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861167
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
2149 (Human, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803918
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
25439 (Rat (Rattus), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045853
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
2149 (Human, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084250
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
378526 (Xenopus laevis, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018028
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
NCBI Accession:
NM_001992
Species:
Human
Synonyms:
F2R, F2r, f2r.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559842
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
NCBI Accession:
NM_012950
Species:
Rat (Rattus)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559844
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
NCBI Accession:
NM_010169
Species:
Mouse (Murine)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3559843
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Coagulation Factor II (thrombin) Receptor
Species:
Human
Synonyms:
CF2R, HTR, PAR-1, PAR1, TR, Par1, TRGPC, AI482343, Cf2r, ThrR, Par-1, f2r-a, par1
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190556
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Species:
Human
Synonyms:
F2R, F2r, f2r.L
Insert length:
1278 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755045
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
14062 (Mouse (Murine), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3808598
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
526585 (Cow (Bovine), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861168
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
2149 (Human, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803916
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
25439 (Rat (Rattus), F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045852
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
2149 (Human, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084251
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
378526 (Xenopus laevis, F2R)
Synonyms:
F2R, F2r, f2r.L
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018029
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Gene ID:
2149 (Human, F2R)
Synonyms:
F2R, F2r, f2r.L
Insert length:
1278 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312422
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
NCBI Accession:
NM_001992,NP_001983
Species:
Human
Synonyms:
F2R, F2r, f2r.L
Insert length:
3870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3383959
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Coagulation Factor II (thrombin) Receptor (F2R)
Species:
Human
Synonyms:
F2R, F2r, f2r.L
Insert length:
1278 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4766990
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to F2R

  • coagulation factor II thrombin receptor (F2R)
  • coagulation factor II (thrombin) receptor (F2r)
  • coagulation factor 2 (thrombin) receptor L homeolog (f2r.L)
  • coagulation factor II thrombin receptor (F2r)
  • AI482343
  • CF2R
  • Cf2r
  • f2r-a
  • HTR
  • PAR-1
  • Par-1
  • PAR1
  • Par1
  • par1
  • ThrR
  • TR
  • TRGPC

Gene-IDs for different species

GENE IDSPECIES
2149 Homo sapiens
25439 Rattus norvegicus
14062 Mus musculus
100521609 Sus scrofa
526585 Bos taurus
378526 Xenopus laevis
100719323 Cavia porcellus

Protein level used designations for F2R

  • protease-activated receptor 1
  • proteinase-activated receptor 1
  • PAR-1
  • Thrombin receptor
  • coagulation factor II receptor
  • thrombin receptor
  • protease-activated receptor-1
  • coagulation factor II (thrombin) receptor
Other products related to F2R such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com