HSPA1A (Heat Shock 70kDa Protein 1A, HSPA1A)

Short Description: This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008].
More information related to gene HSPA1A.
Products related to HSPA1A Gene:
124 Products
Data Quality
  • 1
  • 2
Type
  • 118
  • 6
Species
  • 57
  • 39
  • 24
  • 2
  • 2
Application
  • 78
  • 27
  • 20
  • 14
  • 1
Fusion tag
  • 44
  • 14
  • 13
  • 10
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 55
  • 31
  • 12
  • 9
  • 6
Insert
  • 50
  • 39
  • 15
  • 8
  • 6
Oligo-Type
  • 5
  • 1
Resistance Gene
  • 59
  • 32
  • 22
  • 5
Expression Type
  • 81
  • 43
  • 26
Selectable Marker
  • 26
  • 26
  • 18
  • 1
Promoter
  • 37
  • 31
  • 25
  • 13
  • 6
Format
  • 61
  • 27
  • 20
  • 16

Type:
ORF
Application:
Protein Expression
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
NM_005345,NP_005336
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5435642
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
NM_005345
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4938646
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
100381020 (Xenopus laevis, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874949
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
282254 (Cow (Bovine), HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839552
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084852
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084851
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084853
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
NM_005345
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887067
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Heat Shock 70kDa Protein 1A
Species:
Human
Synonyms:
hsp70-4, hspa1a, Hsp70-3, Hsp70.3, Hsp72, hsp68, hsp70A1, HSP72, Hsp70-1, Hspa1, Hspa1b, hsp70-1, hsp70-1a, hsp70i, hsp72, hspa1, hspa1b, HSP70-1, HSP70-1A, HSP70I, HSPA1, HSPA1A, HSPA1B, HSP70-2, HSPA2, HSP70, hspA1A
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189840
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5750907
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
100381020 (Xenopus laevis, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874950
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
282254 (Cow (Bovine), HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839553
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084854
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084856
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4084855
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312692
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
NM_005345,NP_005336
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
2550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3384539
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
NM_005345,NP_005336
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317721
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4476724
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Heat Shock 70kDa Protein 1A (HSPA1A)
Species:
Human
Synonyms:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4768392
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to HSPA1A

  • heat shock cognate 70-kd protein, tandem duplicate 3 (hsp70.3)
  • heat shock 70 kDa protein 1 (LOC100023597)
  • heat shock 70 kDa protein II (LOC100554002)
  • heat shock 70 kDa protein 1 (LOC100608888)
  • heat shock protein 1A (Hspa1a)
  • heat shock 70kD protein 1A (Hspa1a)
  • heat shock protein family A (Hsp70) member 1A S homeolog (hspa1a.S)
  • heat shock protein family A (Hsp70) member 1A (HSPA1A)
  • heat shock protein 70.2 (HSP70.2)
  • heat shock 70kDa protein 1A (HSPA1A)
  • heat shock 70 kDa protein 1B (LOC100354037)
  • heat shock protein 70.1 (HSP70.1)
  • hsp68
  • HSP70
  • HSP70-1
  • Hsp70-1
  • hsp70-1
  • HSP70-1A
  • hsp70-1a
  • HSP70-2
  • Hsp70-3
  • hsp70-4
  • Hsp70.3
  • hsp70A1
  • HSP70I
  • hsp70i
  • hsp72
  • HSP72
  • Hsp72
  • hspa1
  • Hspa1
  • HSPA1
  • hspa1a
  • HSPA1A
  • hspA1A
  • hspa1b
  • Hspa1b
  • HSPA1B
  • HSPA2

Gene-IDs for different species

GENE IDSPECIES
30671 Danio rerio
100023597 Monodelphis domestica
100554002 Anolis carolinensis
100608888 Pan troglodytes
193740 Mus musculus
24472 Rattus norvegicus
100381020 Xenopus laevis
3303 Homo sapiens
396648 Sus scrofa
282254 Bos taurus
100913152 Ovis aries
100354037 Oryctolagus cuniculus
100860849 Capra hircus
100050827 Equus caballus

Protein level used designations for HSPA1A

  • etID309743.10
  • heat shock 70kD protein 1A
  • stress protein HSP70
  • heat shock 70kDa protein 1A
  • 68 kDa heat shock protein
  • heat shock 70 kDa protein 1A
  • heat shock 70 kDa protein 3
  • heat shock protein, 70 kDa 3
  • inducible heat shock protein 70
  • HSP70-1/HSP70-2
  • HSP70.1/2
  • HSP70.1/HSP70.2
  • heat shock 70 kDa protein 1/2
  • heat shock 70 kDa protein 1A/1B
  • heat shock protein 70-1
  • dnaK-type molecular chaperone HSP70-1
  • heat shock-induced protein
  • heat shock 70 kDa protein 1B
  • heat shock 70 kDa protein 2
  • heat shock 70kDa protein 1B
  • 70 kda heat shock protein-2
  • HSP70.2
  • chaperone
  • heat shock 70 kD protein 2
  • heat-shock 70-kilodalton protein 1B
  • heat shock protein 70
  • heat shock protein 70.1
  • heat-shock protein 70
Other products related to HSPA1A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com