HSPA1A (Heat Shock 70kDa Protein 1A, HSPA1A)

Short Description: This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008].
More information related to gene HSPA1A.
Products related to HSPA1A Gene:
124 Products
Data Quality
  • 1
  • 2
  • 118
  • 6
  • 57
  • 39
  • 24
  • 2
  • 2
  • 78
  • 27
  • 20
  • 14
  • 1
Fusion tag
  • 44
  • 14
  • 13
  • 10
  • 7
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 55
  • 31
  • 12
  • 9
  • 6
  • 50
  • 39
  • 15
  • 8
  • 6
  • 5
  • 1
Resistance Gene
  • 59
  • 32
  • 22
  • 5
Expression Type
  • 81
  • 43
  • 26
Selectable Marker
  • 26
  • 26
  • 18
  • 1
  • 37
  • 31
  • 25
  • 13
  • 6
  • 61
  • 27
  • 20
  • 16
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5750907
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5435642
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4938646
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084852
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084853
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084851
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
100381020 (Xenopus laevis, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3874949
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
282254 (Cow (Bovine), HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3839552
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Quantitative real-time PCR
Heat Shock 70kDa Protein 1A
hsp70-4, hspa1a, Hsp70-3, Hsp70.3, Hsp72, hsp68, hsp70A1, HSP72, Hsp70-1, Hspa1, Hspa1b, hsp70-1, hsp70-1a, hsp70i, hsp72, hspa1, hspa1b, HSP70-1, HSP70-1A, HSP70I, HSPA1, HSPA1A, HSPA1B, HSP70-2, HSPA2, HSP70, hspA1A
-20 °C
Catalog No. ABIN3189840
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN3887067
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
100381020 (Xenopus laevis, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3874950
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression, Cloning
Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
282254 (Cow (Bovine), HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3839553
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084854
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084856
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4084855
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Heat Shock 70kDa Protein 1A (HSPA1A)
Gene ID:
3303 (Human, HSPA1A)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Insert length:
1926 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5312692
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
Mouse (Murine)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3945352
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
Mouse (Murine)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3945358
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
Mouse (Murine)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3945357
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Protein Expression
Heat Shock 70kDa Protein 1A (HSPA1A)
NCBI Accession:
Mouse (Murine)
hsp70.3, LOC100023597, LOC100554002, LOC100608888, Hspa1a, hspa1a.S, HSPA1A, HSP70.2, LOC100354037, HSP70.1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3945360
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to HSPA1A

  • heat shock cognate 70-kd protein, tandem duplicate 3 (hsp70.3)
  • heat shock 70 kDa protein 1 (LOC100023597)
  • heat shock 70 kDa protein II (LOC100554002)
  • heat shock 70 kDa protein 1 (LOC100608888)
  • heat shock protein 1A (Hspa1a)
  • heat shock 70kD protein 1A (Hspa1a)
  • heat shock protein family A (Hsp70) member 1A S homeolog (hspa1a.S)
  • heat shock protein family A (Hsp70) member 1A (HSPA1A)
  • heat shock protein 70.2 (HSP70.2)
  • heat shock 70kDa protein 1A (HSPA1A)
  • heat shock 70 kDa protein 1B (LOC100354037)
  • heat shock protein 70.1 (HSP70.1)
  • hsp68
  • HSP70
  • HSP70-1
  • Hsp70-1
  • hsp70-1
  • HSP70-1A
  • hsp70-1a
  • HSP70-2
  • Hsp70-3
  • hsp70-4
  • Hsp70.3
  • hsp70A1
  • HSP70I
  • hsp70i
  • hsp72
  • HSP72
  • Hsp72
  • hspa1
  • Hspa1
  • HSPA1
  • hspa1a
  • HSPA1A
  • hspA1A
  • hspa1b
  • Hspa1b
  • HSPA1B
  • HSPA2

Gene-IDs for different species

30671 Danio rerio
100023597 Monodelphis domestica
100554002 Anolis carolinensis
100608888 Pan troglodytes
193740 Mus musculus
24472 Rattus norvegicus
100381020 Xenopus laevis
3303 Homo sapiens
396648 Sus scrofa
282254 Bos taurus
100913152 Ovis aries
100354037 Oryctolagus cuniculus
100860849 Capra hircus
100050827 Equus caballus

Protein level used designations for HSPA1A

  • etID309743.10
  • heat shock 70kD protein 1A
  • stress protein HSP70
  • heat shock 70kDa protein 1A
  • 68 kDa heat shock protein
  • heat shock 70 kDa protein 1A
  • heat shock 70 kDa protein 3
  • heat shock protein, 70 kDa 3
  • inducible heat shock protein 70
  • HSP70-1/HSP70-2
  • HSP70.1/2
  • HSP70.1/HSP70.2
  • heat shock 70 kDa protein 1/2
  • heat shock 70 kDa protein 1A/1B
  • heat shock protein 70-1
  • dnaK-type molecular chaperone HSP70-1
  • heat shock-induced protein
  • heat shock 70 kDa protein 1B
  • heat shock 70 kDa protein 2
  • heat shock 70kDa protein 1B
  • 70 kda heat shock protein-2
  • HSP70.2
  • chaperone
  • heat shock 70 kD protein 2
  • heat-shock 70-kilodalton protein 1B
  • heat shock protein 70
  • heat shock protein 70.1
  • heat-shock protein 70
Other products related to HSPA1A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com