TNFRSF25 (Tumor Necrosis Factor Receptor Superfamily, Member 25, TNFRSF25)

Short Description: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008].
More information related to gene TNFRSF25.
Products related to TNFRSF25 Gene:
  • 129
  • 3
  • 79
  • 28
  • 25
  • 86
  • 23
  • 20
  • 16
  • 1
Fusion tag
  • 37
  • 25
  • 22
  • 11
  • 8
Vector Backbone
  • 13
  • 13
  • 11
  • 6
  • 6
  • 49
  • 49
  • 12
  • 9
  • 7
  • 58
  • 37
  • 18
  • 8
  • 6
  • 2
  • 1
Resistance Gene
  • 48
  • 44
  • 32
  • 5
  • 2
Expression Type
  • 111
  • 53
  • 11
Selectable Marker
  • 35
  • 26
  • 11
  • 54
  • 28
  • 21
  • 14
  • 8
  • 68
  • 27
  • 26
  • 11
132 Products

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5345487
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Insert length:
546 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4934463
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4000882
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4000883
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
85030 (Mouse, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3828336
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3604377
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Tumor Necrosis Factor Receptor Superfamily, Member 25
APO-3, DDR3, DR3, LARD, TNFRSF12, TR3, TRAMP, WSL-1, WSL-LR, Tnfrsf12, Wsl, TNFRSF25
-20 °C
Catalog No. ABIN3189958
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4000884
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4000885
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
85030 (Mouse, TNFRSF25)
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3828335
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
TNFRSF25, Tnfrsf25
Insert length:
1254 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5326649
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604366
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604368
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604369
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604370
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604372
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
HA tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604373
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
His tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604374
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Fusion Tag:
MYC tag

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604375
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Protein Expression
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
Catalog No. ABIN3604376
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TNFRSF25

  • TNF receptor superfamily member 25 (TNFRSF25)
  • tumor necrosis factor receptor superfamily, member 25 (Tnfrsf25)
  • TNF receptor superfamily member 25 (Tnfrsf25)
  • APO-3
  • DDR3
  • DR3
  • LARD
  • TNFRSF12
  • Tnfrsf12
  • TNFRSF25
  • TR3
  • Wsl
  • WSL-1
  • WSL-LR

Gene-IDs for different species

8718 Homo sapiens
85030 Mus musculus
489632 Canis lupus familiaris
500592 Rattus norvegicus
703744 Macaca mulatta
749145 Pan troglodytes
783432 Bos taurus
100594987 Nomascus leucogenys
100724303 Cavia porcellus

Protein level used designations for TNFRSF25

  • apoptosis inducing receptor
  • apoptosis-inducing receptor AIR
  • apoptosis-mediating receptor DR3
  • apoptosis-mediating receptor TRAMP
  • death domain receptor 3 soluble form
  • death receptor beta
  • lymphocyte-associated receptor of death
  • protein WSL-1
  • tumor necrosis factor receptor superfamily member 25
  • tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)
  • tumor necrosis factor receptor superfamily, member 12
  • tumor necrosis factor receptor superfamily, member 25
  • translocating chain-association membrane protein
  • tumor necrosis factor receptor superfamily, member12
Other products related to TNFRSF25 such as antibodies, ELISA kits and high-purity proteins are available on our partner website