TNFRSF25 (Tumor Necrosis Factor Receptor Superfamily, Member 25, TNFRSF25)

Short Description: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed preferentially in the tissues enriched in lymphocytes, and it may play a role in regulating lymphocyte homeostasis. This receptor has been shown to stimulate NF-kappa B activity and regulate cell apoptosis. The signal transduction of this receptor is mediated by various death domain containing adaptor proteins. Knockout studies in mice suggested the role of this gene in the removal of self-reactive T cells in the thymus. Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported, most of which are potentially secreted molecules. The alternative splicing of this gene in B and T cells encounters a programmed change upon T-cell activation, which predominantly produces full-length, membrane bound isoforms, and is thought to be involved in controlling lymphocyte proliferation induced by T-cell activation. [provided by RefSeq, Jul 2008].
More information related to gene TNFRSF25.
Products related to TNFRSF25 Gene:
133 Products
Type
  • 130
  • 3
Species
  • 80
  • 28
  • 25
Application
  • 86
  • 23
  • 21
  • 16
  • 1
Fusion tag
  • 37
  • 26
  • 22
  • 11
  • 8
Vector Backbone
  • 13
  • 13
  • 11
  • 6
  • 6
Vector
  • 50
  • 49
  • 12
  • 9
  • 7
Insert
  • 58
  • 37
  • 19
  • 8
  • 6
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 49
  • 44
  • 32
  • 5
  • 2
Expression Type
  • 112
  • 54
  • 11
Selectable Marker
  • 36
  • 26
  • 11
Promoter
  • 55
  • 29
  • 21
  • 14
  • 8
Format
  • 69
  • 27
  • 26
  • 11

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148967,NP_683868
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5345487
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_001039664
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Insert length:
546 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4934463
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
85030 (Mouse (Murine), TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828336
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000882
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000883
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604377
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25
Species:
Human
Synonyms:
APO-3, DDR3, DR3, LARD, TNFRSF12, TR3, TRAMP, WSL-1, WSL-LR, Tnfrsf12, Wsl, TNFRSF25
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189958
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
85030 (Mouse (Murine), TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3828335
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000885
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000884
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
Gene ID:
8718 (Human, TNFRSF25)
Synonyms:
TNFRSF25, Tnfrsf25
Insert length:
1254 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326649
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604366
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604368
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604369
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604370
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604374
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604373
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604372
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604376
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 25 (TNFRSF25)
NCBI Accession:
NM_148965
Species:
Human
Synonyms:
TNFRSF25, Tnfrsf25
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3604375
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TNFRSF25

  • TNF receptor superfamily member 25 (TNFRSF25)
  • tumor necrosis factor receptor superfamily, member 25 (Tnfrsf25)
  • TNF receptor superfamily member 25 (Tnfrsf25)
  • APO-3
  • DDR3
  • DR3
  • LARD
  • TNFRSF12
  • Tnfrsf12
  • TNFRSF25
  • TR3
  • TRAMP
  • Wsl
  • WSL-1
  • WSL-LR

Gene-IDs for different species

GENE IDSPECIES
8718 Homo sapiens
85030 Mus musculus
489632 Canis lupus familiaris
500592 Rattus norvegicus
703744 Macaca mulatta
749145 Pan troglodytes
783432 Bos taurus
100594987 Nomascus leucogenys
100724303 Cavia porcellus

Protein level used designations for TNFRSF25

  • apoptosis inducing receptor
  • apoptosis-inducing receptor AIR
  • apoptosis-mediating receptor DR3
  • apoptosis-mediating receptor TRAMP
  • death domain receptor 3 soluble form
  • death receptor beta
  • lymphocyte-associated receptor of death
  • protein WSL-1
  • tumor necrosis factor receptor superfamily member 25
  • tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)
  • tumor necrosis factor receptor superfamily, member 12
  • tumor necrosis factor receptor superfamily, member 25
  • translocating chain-association membrane protein
  • tumor necrosis factor receptor superfamily, member12
Other products related to TNFRSF25 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com