Tumor Necrosis Factor (Tumor Necrosis Factor, TNF)

Short Description: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. This cytokine is mainly secreted by macrophages. It can bind to, and thus functions through its receptors TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. This cytokine is involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. This cytokine has been implicated in a variety of diseases, including autoimmune diseases, insulin resistance, and cancer. Knockout studies in mice also suggested the neuroprotective function of this cytokine. [provided by RefSeq, Jul 2008].
More information related to gene Tumor Necrosis Factor.
Products related to Tumor Necrosis Factor Gene:
183 Products
Data Quality
  • 1
  • 4
Type
  • 176
  • 7
Species
  • 56
  • 45
  • 42
  • 12
  • 12
Application
  • 127
  • 35
  • 25
  • 18
  • 3
Fusion tag
  • 62
  • 21
  • 16
  • 15
  • 13
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 100
  • 38
  • 12
  • 9
  • 7
Insert
  • 90
  • 47
  • 21
  • 10
  • 8
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 97
  • 56
  • 18
  • 5
Expression Type
  • 96
  • 66
  • 53
Selectable Marker
  • 66
  • 33
  • 26
  • 1
Promoter
  • 80
  • 33
  • 31
  • 13
  • 8
Format
  • 111
  • 27
  • 25
  • 20

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_000594,NP_000585
Species:
Human
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Insert length:
702 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5383559
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
7124 (Human, TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098090
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
280943 (Cow (Bovine), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838478
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
7124 (Human, TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465245
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
24835 (Rat (Rattus), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878930
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
21926 (Mouse (Murine), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004001
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
21926 (Mouse (Murine), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004003
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_012675
Species:
Rat (Rattus)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603719
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_001003244
Species:
Dog (Canine)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566044
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_001047149
Species:
Rhesus Monkey
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566042
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_000594
Species:
Human
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566045
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
Species:
Ferret
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566043
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
NCBI Accession:
NM_013693
Species:
Mouse (Murine)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566046
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor
NCBI Accession:
NM_000594
Species:
Human
Synonyms:
DIF, TNF-alpha, TNFA, TNFSF2, RATTNF, Tnfa, tnf, TNF-a, TNFalpha, Tnfsf1a, TNFa, cTNF, Tnf-alpha, tnfa-like, TNF-ALPHA, dif, tnfa, xtnf, tnfsf2, tnf-alpha, Cachectin
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188927
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor
Species:
Rat (Rattus)
Synonyms:
DIF, TNF-alpha, TNFA, TNFSF2, RATTNF, Tnfa, tnf, TNF-a, TNFalpha, Tnfsf1a, TNFa, cTNF, Tnf-alpha, tnfa-like, TNF-ALPHA, dif, tnfa, xtnf, tnfsf2, tnf-alpha, Cachectin
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196209
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor
Species:
Mouse (Murine)
Synonyms:
DIF, TNF-alpha, TNFA, TNFSF2, RATTNF, Tnfa, tnf, TNF-a, TNFalpha, Tnfsf1a, TNFa, cTNF, Tnf-alpha, tnfa-like, TNF-ALPHA, dif, tnfa, xtnf, tnfsf2, tnf-alpha, Cachectin
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193926
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
Tumor Necrosis Factor (TNF)
Species:
Human
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Insert length:
702 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735036
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
280943 (Cow (Bovine), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838479
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
7124 (Human, TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465246
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor (TNF)
Gene ID:
24835 (Rat (Rattus), TNF)
Synonyms:
TNF, Tnf, tnf, tnfb, tnf-alpha, LOC103694380, tnfa
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878931
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to Tumor Necrosis Factor

  • tumor necrosis factor (TNF)
  • tumor necrosis factor (Tnf)
  • tumor necrosis factor (tnf)
  • tumor necrosis factor b (TNF superfamily, member 2) (tnfb)
  • tumor necrosis factor alpha (tnf-alpha)
  • tumor necrosis factor (LOC103694380)
  • tumor necrosis factor a (TNF superfamily, member 2) (tnfa)
  • Cachectin
  • cTNF
  • dif
  • DIF
  • RATTNF
  • tnf
  • TNF-a
  • TNF-ALPHA
  • tnf-alpha
  • Tnf-alpha
  • TNF-alpha
  • Tnfa
  • TNFA
  • tnfa
  • TNFa
  • tnfa-like
  • TNFalpha
  • Tnfsf1a
  • TNFSF2
  • tnfsf2
  • xtnf

Gene-IDs for different species

GENE IDSPECIES
7124 Homo sapiens
24835 Rattus norvegicus
100136064 Oncorhynchus mykiss
100304592 Ictalurus punctatus
21926 Mus musculus
280943 Bos taurus
397086 Sus scrofa
403922 Canis lupus familiaris
443540 Ovis aries
554167 Danio rerio
715467 Macaca mulatta
100033834 Equus caballus
100134991 Xenopus (Silurana) tropicalis
100137091 Salmo salar
100397484 Callithrix jacchus
100135630 Cavia porcellus
100009088 Oryctolagus cuniculus
493755 Felis catus
101420445 Dasypus novemcinctus
494186 Pan troglodytes
101318178 Tursiops truncatus
100861232 Capra hircus
103694380 Rattus norvegicus
102139631 Macaca fascicularis
405785 Danio rerio
101687148 Mustela putorius furo

Protein level used designations for Tumor Necrosis Factor

  • APC1 protein
  • TNF, macrophage-derived
  • TNF, monocyte-derived
  • TNF-a
  • cachectin
  • tumor necrosis factor ligand superfamily member 2
  • tumor necrosis factor-alpha
  • tumor necrosis factor (TNF superfamily, member 2)
  • tumor necrosis factor alpha
  • tumor necrosis factor
  • TNF-alpha
  • tumor-necrosis factor
  • tumour necrosis factor
  • TNF alpha
  • TNF2
  • lta
  • ATP-binding cassette, sub-family F (GCN20), member 1
  • tumour necrosis factor alpha
  • tumor necrosis factor, alpha
  • Cachectin
  • Tumor necrosis factor ligand superfamily member 2
  • TNF-alpha 1
  • TNF1
Other products related to Tumor Necrosis Factor such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com