YWHAZ (Tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide, YWHAZ)

Short Description: This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008].
More information related to gene YWHAZ.
Products related to YWHAZ Gene:
Type
  • 230
  • 4
Species
  • 89
  • 73
  • 45
  • 14
  • 5
Application
  • 154
  • 72
  • 20
  • 20
  • 2
Fusion tag
  • 83
  • 26
  • 23
  • 20
  • 14
Vector Backbone
  • 11
  • 11
  • 11
  • 11
  • 8
Vector
  • 116
  • 49
  • 28
  • 24
  • 9
Insert
  • 96
  • 96
  • 18
  • 10
  • 8
Oligo-Type
  • 2
  • 2
Resistance Gene
  • 112
  • 76
  • 36
  • 6
  • 2
Expression Type
  • 152
  • 67
  • 52
Selectable Marker
  • 52
  • 47
  • 28
Promoter
  • 77
  • 60
  • 32
  • 26
  • 10
Format
  • 110
  • 54
  • 44
  • 26
234 Products

Type:
ORF
Application:
Protein Expression
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
NCBI Accession:
NM_003406,NP_003397
Species:
Human
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Insert length:
738 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5420881
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
NCBI Accession:
NM_145690,NP_663723
Species:
Human
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Insert length:
738 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5420882
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
336610 (Zebrafish (Danio rerio), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040635
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
336610 (Zebrafish (Danio rerio), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4040636
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
336610 (Zebrafish (Danio rerio), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462467
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000625
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
379608 (Xenopus laevis, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041103
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
25578 (Rat (Rattus), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045928
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
25578 (Rat (Rattus), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045929
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087440
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
22631 (Mouse (Murine), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099930
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
22631 (Mouse (Murine), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4099931
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211623
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805809
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805810
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805811
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
7534 (Human, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805812
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
287022 (Cow (Bovine), YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840331
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
379809 (Xenopus laevis, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843110
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
tyrosine 3-Monooxygenase/tryptophan 5-Monooxygenase Activation Protein, zeta Polypeptide (YWHAZ)
Gene ID:
394780 (Xenopus tropicalis, YWHAZ)
Synonyms:
YWHAZ, 14-3-3zeta, ywhaz, 1433z, ywhaz.L, Ywhaz, ywhaz.S, LOC100855903
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3881876
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...

Synonyms and alternative names related to YWHAZ

  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ)
  • 14-3-3 protein zeta (14-3-3zeta)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (ywhaz)
  • 14-3-3 protein zeta (1433z)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta L homeolog (ywhaz.L)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta (Ywhaz)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta S homeolog (ywhaz.S)
  • 14-3-3 protein zeta/delta pseudogene (LOC100855903)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (ywhaz)
  • CG17870 gene product from transcript CG17870-RE (14-3-3zeta)
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (Ywhaz)
  • 2G1
  • 4-3-3 zeta
  • 5.11
  • 14-3-3
  • 14-3-3 zeta
  • 14-3-3-zeta
  • 14-3-3leo
  • 14-3-3z
  • 14-3-3zeta
  • 14-3-3ZETA
  • 549
  • 1433z
  • 1110013I11Rik
  • ACYPI003154
  • AI596267
  • AL022924
  • AU020854
  • BEST:GH05075
  • CG17870
  • D14-3-3
  • D14-3-3zeta
  • d14-3-3zeta
  • Dmel\\CG17870
  • fb14h09
  • K
  • KCIP-1
  • kcip-1
  • l(2)07103
  • l(2)46CFe
  • l(2)46Ee
  • Leo
  • LEO
  • leo
  • Par-5
  • PAR-5
  • par-5
  • PAR5
  • wu:fb05g08
  • wu:fb14h09
  • YWHAD
  • ywhai
  • ywhaq
  • ywhaz
  • Ywhaz
  • ywhaza
  • ywhazb
  • zgc:55807

Gene-IDs for different species

GENE IDSPECIES
7534 Homo sapiens
692854 Bombyx mori
100161970 Acyrthosiphon pisum
394780 Xenopus (Silurana) tropicalis
100196314 Salmo salar
379608 Xenopus laevis
287022 Bos taurus
100173609 Pongo abelii
22631 Mus musculus
25578 Rattus norvegicus
379809 Xenopus laevis
425619 Gallus gallus
100855903 Canis lupus familiaris
780440 Sus scrofa
336610 Danio rerio
475864 Canis lupus familiaris
36059 Drosophila melanogaster
780452 Ovis aries
100727182 Cavia porcellus
709723 Macaca mulatta

Protein level used designations for YWHAZ

  • 14-3-3 delta
  • 14-3-3 protein zeta/delta
  • 14-3-3 protein/cytosolic phospholipase A2
  • 14-3-3 zeta
  • phospholipase A2
  • protein kinase C inhibitor protein 1
  • protein kinase C inhibitor protein-1
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide
  • tyrosine 3/tryptophan 5 -monooxygenase activation protein, zeta polypeptide
  • 14-3-3zeta
  • 14-3-3 protein zeta
  • tyrosine 3-monooxygenase protein zeta polypeptide
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide b
  • FAS
  • KCIP-1
  • factor activating exoenzyme S
  • SEZ-2
  • mitochondrial import stimulation factor S1 subunit
  • 14-3-3 protein zeta a
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide a
  • tyrosine 3/tryptophan 5-monooxygenase activation protein zeta polypeptide
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, iota polypeptide
  • 14-3-3zeta-PA
  • 14-3-3zeta-PB
  • 14-3-3zeta-PC
  • 14-3-3zeta-PD
  • 14-3-3zeta-PE
  • 14-3-3zeta-PF
  • 14-3-3zeta-PG
  • 14-3-3zeta-PH
  • 14-3-3zeta-PI
  • 14-3-3zeta-PJ
  • 14-3-3zeta-PK
  • 14-3-3zeta-PL
  • CG17870-PA
  • CG17870-PB
  • CG17870-PC
  • CG17870-PD
  • CG17870-PE
  • CG17870-PF
  • CG17870-PG
  • CG17870-PH
  • CG17870-PI
  • CG17870-PJ
  • CG17870-PK
  • CG17870-PL
  • D14 3 3 protein
  • Leonardo-13-3-3
  • complementation group K
  • leonardo
  • leonardo 14-3-3
  • tyrosine 3-monooxygenase
  • tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Other products related to YWHAZ such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com