Human SLX1A CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)
Quick Overview for Human SLX1A CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag) (ABIN3223809)
Gene
Fusion tag
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- kn400806
-
Supplier
- OriGene
-
Purpose
- Knockout Kit for Human SLX1A via CRISPR.
-
Characteristics
-
- The SLX1A kit is designed based on the best knowledge of CRISPR technology.
- The system has been functionally validated for knocking-in the cassette downstream the native promoter.
- The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
-
Components
-
- SLX1A gRNA vector 1 in pCAS-Guide vector.
- SLX1A gRNA vector 2 in pCAS-Guide vector.
- Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
- Scramble sequence in pCas-Guide vector
-
Sequencing Primer
- CF3 (ACGATACAAGGCTGTTAGAGAG)
-
-
![Human SLX1A ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human SLX1A ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human SLX1A cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human SLX1A cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human SLX1A cDNA Clone in Mammalian Expression Vector]()
Human SLX1A cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-AC Ampicillin Enhanced CMV Promoter unconjugated Transient
![Human SLX1A ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human SLX1A ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human SLX1A ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human SLX1A ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human SLX1A ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)]()
Human SLX1A ORF Clone in Lentiviral Vector (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Application Notes
-
- Knock-in GFP reporter for promoter study.
- Knock-out genes at chromosomal level.
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- -20 °C
-
-
- SLX1 Structure-Specific Endonuclease Subunit Homolog A (S. Cerevisiae) (SLX1A)
-
Alternative Name
- SLX1A
Target
-
