Human SSX7 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)
Quick Overview for Human SSX7 cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag) (ABIN3305553)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc306814
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SSX7 is ideal for over-expression of native protein for functional studies.
-
Specificity
- With the native stop codon at the end of the ORF the C-terminal Myc-DDK tag in the vector won't be expressed.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human SSX7 shRNA in Retroviral Vector]()
Human SSX7 shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human SSX7 shRNA in Retroviral Vector (GFP tag)]()
Human SSX7 shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human SSX7 shRNA in Lentiviral Vector (GFP tag)]()
Human SSX7 shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human SSX7 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human SSX7 CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
![Human SSX7 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human SSX7 ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- SSX7 (Synovial Sarcoma, X Breakpoint 7 (SSX7))
-
Alternative Name
- SSX7
-
Background
- The product of this gene belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. They are also capable of eliciting spontaneously humoral and cellular immune responses in cancer patients, and are potentially useful targets in cancer vaccine-based immunotherapy. SSX1, SSX2 and SSX4 genes have been involved in the t(X,18) translocation characteristically found in all synovial sarcomas. This gene appears not to be involved in this type of chromosome translocation. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_173358, NP_775494
Target
-
