Human TCEB3C cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)
Quick Overview for Human TCEB3C cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag) (ABIN3305838)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc306250
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human TCEB3C is ideal for over-expression of native protein for functional studies.
-
Specificity
- With the native stop codon at the end of the ORF the C-terminal Myc-DDK tag in the vector won't be expressed.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human TCEB3C ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)]()
Human TCEB3C ORF Clone in Lenti Particles (Myc-DYKDDDDK Tag)ORF PExp Lentiviral Vector pLenti-C-Myc-DDK Chloramphenicol CMV Promoter Myc-DYKDDDDK Tag Transient
![Human TCEB3C ORF Clone in Lenti Particles (GFP tag)]()
Human TCEB3C ORF Clone in Lenti Particles (GFP tag)ORF PExp Lentiviral Vector pLenti-C-mGFP Chloramphenicol CMV Promoter GFP tag Transient
![Human TCEB3C shRNA in Retroviral Vector]()
Human TCEB3C shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
![Human TCEB3C shRNA in Lentiviral Vector (GFP tag)]()
Human TCEB3C shRNA in Lentiviral Vector (GFP tag)shRNA RNAi Lentiviral Vector pGFP-C-shLenti Chloramphenicol U6 Promoter GFP tag Transient
![Human TCEB3C shRNA in Retroviral Vector (GFP tag)]()
Human TCEB3C shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human TCEB3C CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human TCEB3C CRISPR gRNA + Cas9 in Mammalian Expression Vector (Myc-DYKDDDDK Tag)gRNA + Cas9 GEEN Mammalian Expression Vector pCas-Guide Ampicillin U6 Promoter Myc-DYKDDDDK Tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- TCEB3C (Transcription Elongation Factor B Polypeptide 3C (Elongin A3) (TCEB3C))
-
Alternative Name
- TCEB3C
-
Background
- The SIII (or elongin) transcription elongation factor complex stimulates the rate of transcription elongation by RNA polymerase II by suppressing the transient pausing of the polymerase at many sites along the DNA template. This complex is a heterotrimer, composed of the transcriptionally active subunit A, A2 or A3 (or elongin A, A2 or A3) and two regulatory subunits, B and C (or elongin B and C). This gene encodes subunit A3. A3 and A are ubiquitously expressed, whereas A2 is specifically expressed in the testis. [provided by RefSeq, Mar 2010].
-
NCBI Accession
- NM_145653, NP_663628
Target
-
