Search Results

Data Quality
  • 3393
Type
  • 503063
  • 53440
  • 1
Gene
  • 330
  • 153
  • 149
  • 146
  • 145
Species
  • 282037
  • 144675
  • 129603
  • 176
Application
  • 269287
  • 248060
  • 39144
  • 12
  • 12
Fusion tag
  • 183182
  • 183643
  • 135728
  • 53951
Vector Backbone
  • 108734
  • 53975
  • 53972
  • 53953
  • 53951
Vector
  • 203233
  • 161879
  • 137951
Insert
  • 215847
  • 172292
  • 75768
  • 39144
  • 12
Oligo-Type
  • 53440
Resistance Gene
  • 191902
  • 162687
  • 148474
Expression Type
  • 503062
  • 253784
  • 1
Selectable Marker
  • 215851
  • 92247
Promoter
  • 254996
  • 172292
  • 114920
  • 16865
  • 804
Format
  • 556503
Next filter by Product Type
    • 503063
    • 53440
    • 1
556,504 Products
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Wnt3a is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 3A (WNT3A)
NCBI Accession:
NM_009522,NP_033548
Species:
Mouse (Murine)
Synonyms:
WNT3A, Wnt3a, wnt3a, wnt3a.L
Insert length:
1059 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Parr, Mirzaei, Christian, Sastre: "Activation of the Wnt/β-catenin pathway represses the transcription of the β-amyloid precursor protein cleaving enzyme (BACE1) via binding of T-cell factor-4 to BACE1 promoter." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 29, Issue 2, pp. 623-35, 2015 (Pubmed)
Catalog No. ABIN3376391
$390.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Stat3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3)
NCBI Accession:
NP_035616
Species:
Mouse (Murine)
Synonyms:
STAT3, stat3, Stat3, stat3.1.L
Insert length:
2169 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Elsarraj, Hong, Valdez, Carletti, Salah, Raimo, Taverna, Prochasson, Bharadwaj, Tweardy, Christenson, Behbod: "A novel role of microRNA146b in promoting mammary alveolar progenitor cell maintenance." in: Journal of cell science, Vol. 126, Issue Pt 11, pp. 2446-58, 2013 (Pubmed)
Catalog No. ABIN3372380
$900.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Stat3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3)
NCBI Accession:
NP_998824
Species:
Mouse (Murine)
Synonyms:
STAT3, stat3, Stat3, stat3.1.L
Insert length:
2313 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kabra, Pfuhlmann, García-Cáceres, Schriever, Casquero García, Kebede, Fuente-Martin, Trivedi, Heppner, Uhlenhaut, Legutko, Kabra, Gao, Yi, Quarta, Clemmensen, Finan, Müller, Meyer, Paez-Pereda et al.: "Hypothalamic leptin action is mediated by histone deacetylase 5. ..." in: Nature communications, Vol. 7, Issue , pp. 10782, 2016 (Pubmed)
  • Elsarraj, Hong, Valdez, Carletti, Salah, Raimo, Taverna, Prochasson, Bharadwaj, Tweardy, Christenson, Behbod: "A novel role of microRNA146b in promoting mammary alveolar progenitor cell maintenance." in: Journal of cell science, Vol. 126, Issue Pt 11, pp. 2446-58, 2013 (Pubmed)
Catalog No. ABIN3372382
$960.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LEO1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leo1, Paf1/RNA Polymerase II Complex Component, Homolog (S. Cerevisiae) (LEO1)
NCBI Accession:
NM_138792,NP_620147
Species:
Human
Synonyms:
LEO1, leo1, LOC100466503, leo1.S, Leo1, LOC415420, LOC478310
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Rozenblatt-Rosen, Hughes, Nannepaga, Shanmugam, Copeland, Guszczynski, Resau, Meyerson: "The parafibromin tumor suppressor protein is part of a human Paf1 complex." in: Molecular and cellular biology, Vol. 25, Issue 2, pp. 612-20, 2005 (Pubmed)
Catalog No. ABIN3378663
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NEDD9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Neural Precursor Cell Expressed, Developmentally Down-Regulated 9 (NEDD9)
NCBI Accession:
NM_006403,NP_006394
Species:
Human
Synonyms:
NEDD9, Nedd9
Insert length:
4310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sima, Cheng, Ye, Ma, Xie, Lü: "The overexpression of scaffolding protein NEDD9 promotes migration and invasion in cervical cancer via tyrosine phosphorylated FAK and SRC." in: PLoS ONE, Vol. 8, Issue 9, pp. e74594, 2013 (Pubmed)
Catalog No. ABIN3379093
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human P2RX5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Purinergic Receptor P2X, Ligand-Gated Ion Channel, 5 (P2RX5)
NCBI Accession:
NM_002561,NP_002552
Species:
Human
Synonyms:
P2RX5, P2rx5
Insert length:
2250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kotnis, Bingham, Vasilyev, Miller, Bai, Yeola, Chanda, Bowlby, Kaftan, Samad, Whiteside: "Genetic and functional analysis of human P2X5 reveals a distinct pattern of exon 10 polymorphism with predominant expression of the nonfunctional receptor isoform." in: Molecular pharmacology, Vol. 77, Issue 6, pp. 953-60, 2010 (Pubmed)
Catalog No. ABIN3379248
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
NM_004620,NP_004611
Species:
Human
Synonyms:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Park, Huang, Lu, Cairo, Zhou: "MicroRNA-146a and microRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteins." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2831-41, 2015 (Pubmed)
Catalog No. ABIN3380442
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VTI1B is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Vesicle Transport through Interaction with T-SNAREs Homolog 1B (Yeast) (VTI1B)
NCBI Accession:
NM_006370,NP_006361
Species:
Human
Synonyms:
VTI1B, Vti1b, vti1b, LOC461624
Insert length:
5550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cheng, Cebotaru, Cebotaru, Guggino: "Syntaxin 6 and CAL mediate the degradation of the cystic fibrosis transmembrane conductance regulator." in: Molecular biology of the cell, Vol. 21, Issue 7, pp. 1178-87, 2010 (Pubmed)
Catalog No. ABIN3380631
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human P4HB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Prolyl 4-Hydroxylase, beta Polypeptide (P4HB)
NCBI Accession:
NM_000918,NP_000909
Species:
Human
Synonyms:
P4HB, P4hb, p4hb.L, LOC8281065
Insert length:
2700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Vatolin, Phillips, Jha, Govindgari, Hu, Grabowski, Parker, Lindner, Zhong, Distelhorst, Smith, Cotta, Xu, Chilakala, Kuang, Tall, Reu: "Novel Protein Disulfide Isomerase Inhibitor with Anticancer Activity in Multiple Myeloma." in: Cancer research, Vol. 76, Issue 11, pp. 3340-50, 2016 (Pubmed)
  • Zhao, Lu, Li: "Proapoptotic activities of protein disulfide isomerase (PDI) and PDIA3 protein, a role of the Bcl-2 protein Bak." in: The Journal of biological chemistry, Vol. 290, Issue 14, pp. 8949-63, 2015 (Pubmed)
  • Lee, Sun, Ho, Kiang, Zhang, Xu, Leung: "Hyperoxia resensitizes chemoresistant glioblastoma cells to temozolomide through unfolded protein response." in: Anticancer research, Vol. 34, Issue 6, pp. 2957-66, 2014 (Pubmed)
  • Pybus, Dean, West, Smith, Daramola, Field, Wilkinson, James: "Model-directed engineering of "difficult-to-express" monoclonal antibody production by Chinese hamster ovary cells." in: Biotechnology and bioengineering, Vol. 111, Issue 2, pp. 372-85, 2014 (Pubmed)
Catalog No. ABIN3379256
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PIM2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Proto-Oncogene Pim-2 (Serine Threonine Kinase) (PIM2)
NCBI Accession:
NM_006875,NP_006866
Species:
Human
Synonyms:
pim2, PIM2, Pim2
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Egli, Zajonz, Burger, Schweighoffer: "Human CD180 Transmits Signals via the PIM-1L Kinase." in: PLoS ONE, Vol. 10, Issue 11, pp. e0142741, 2015 (Pubmed)
Catalog No. ABIN3379412
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PURA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Purine-Rich Element Binding Protein A (PURA)
NCBI Accession:
NM_005859,NP_005850
Species:
Human
Synonyms:
pura, Pura, PURA, puraa, pura.L
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3379641
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CYP1A1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cytochrome P450, Family 1, Subfamily A, Polypeptide 1 (CYP1A1)
NCBI Accession:
NM_000499,NP_000490
Species:
Human
Synonyms:
CYP1A1, CYP1D1, CpipJ_CPIJ010542, cyp1d1, Cyp1a1, LOC100328613
Insert length:
2310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kekatpure, Dannenberg, Subbaramaiah: "HDAC6 modulates Hsp90 chaperone activity and regulates activation of aryl hydrocarbon receptor signaling." in: The Journal of biological chemistry, Vol. 284, Issue 12, pp. 7436-45, 2009 (Pubmed)
Catalog No. ABIN3377645
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CXCR1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Receptor 1 (CXCR1)
NCBI Accession:
NM_000634,NP_000625
Species:
Human
Synonyms:
CXCR1, Cxcr1, LOC100461947, cxcr1.S
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Shinoda, Shinya, Ito, Ishizuka-Katsura, Ohsawa, Terada, Hirata, Kawano, Yamamoto, Tomita, Ishibashi, Hirabayashi, Kimura-Someya, Shirouzu, Yokoyama: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, Issue , pp. 30442, 2016 (Pubmed)
  • Palanisamy, Park, Wang, Wong: "AUF1 and HuR proteins stabilize interleukin-8 mRNA in human saliva." in: Journal of dental research, Vol. 87, Issue 8, pp. 772-6, 2008 (Pubmed)
Catalog No. ABIN3377634
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 2 (TRAF2)
NCBI Accession:
NM_021138,NP_066961
Species:
Human
Synonyms:
LOC661716, traF2, TRAF2, Traf2
Insert length:
2560 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Charlaftis, Suddason, Wu, Anwar, Karin, Gallagher: "The MEKK1 PHD ubiquitinates TAB1 to activate MAPKs in response to cytokines." in: The EMBO journal, Vol. 33, Issue 21, pp. 2581-96, 2014 (Pubmed)
Catalog No. ABIN3380439
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human STAT3 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 3 (Acute-Phase Response Factor) (STAT3)
NCBI Accession:
NM_139276,NP_644805
Species:
Human
Synonyms:
STAT3, stat3, Stat3, stat3.1.L
Insert length:
3384 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lee, Kim, Kim, Han, Kang, Cho: "STAT3-induced WDR1 overexpression promotes breast cancer cell migration." in: Cellular signalling, Vol. 28, Issue 11, pp. 1753-60, 2016 (Pubmed)
  • Rozovski, Harris, Li, Liu, Wu, Grgurevic, Faderl, Ferrajoli, Wierda, Martinez, Verstovsek, Keating, Estrov: "At High Levels, Constitutively Activated STAT3 Induces Apoptosis of Chronic Lymphocytic Leukemia Cells." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 196, Issue 10, pp. 4400-9, 2016 (Pubmed)
  • Gemelli, Zanocco Marani, Bicciato, Mazza, Boraschi, Salsi, Zappavigna, Parenti, Selmi, Tagliafico, Ferrari, Grande: "MafB is a downstream target of the IL-10/STAT3 signaling pathway, involved in the regulation of macrophage de-activation." in: Biochimica et biophysica acta, Vol. 1843, Issue 5, pp. 955-64, 2014 (Pubmed)
  • Kirchmer, Franco, Albasanz-Puig, Murray, Yagi, Gao, Dong, Wijelath: "Modulation of vascular smooth muscle cell phenotype by STAT-1 and STAT-3." in: Atherosclerosis, Vol. 234, Issue 1, pp. 169-75, 2014 (Pubmed)
  • Sarma, Tiriveedhi, Crippin, Chapman, Mohanakumar: "Hepatitis C virus-induced changes in microRNA 107 (miRNA-107) and miRNA-449a modulate CCL2 by targeting the interleukin-6 receptor complex in hepatitis." in: Journal of virology, Vol. 88, Issue 7, pp. 3733-43, 2014 (Pubmed)
  • Xie, Kole, Precht, Pazin, Bernier: "S-glutathionylation impairs signal transducer and activator of transcription 3 activation and signaling." in: Endocrinology, Vol. 150, Issue 3, pp. 1122-31, 2009 (Pubmed)
  • Canaff, Zhou, Hendy: "The proinflammatory cytokine, interleukin-6, up-regulates calcium-sensing receptor gene transcription via Stat1/3 and Sp1/3." in: The Journal of biological chemistry, Vol. 283, Issue 20, pp. 13586-600, 2008 (Pubmed)
  • Show more References
Catalog No. ABIN3380197
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human WNT4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 4 (WNT4)
NCBI Accession:
NM_030761,NP_110388
Species:
Human
Synonyms:
WNT4, Wnt4, wnt4.S, wnt4a
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ring, Neth, Weber, Steffens, Faussner et al.: "β-Catenin-dependent pathway activation by both promiscuous "canonical" WNT3a-, and specific "noncanonical" WNT4- and WNT5a-FZD receptor combinations with strong differences in LRP5 and LRP6 ..." in: Cellular signalling, Vol. 26, Issue 2, pp. 260-7, 2013 (Pubmed)
Catalog No. ABIN3380666
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
NM_145803,NP_665802
Species:
Human
Synonyms:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhou, Wang, Schwartz, Stoffels, Park, Zhang, Yang, Demirkaya, Takeuchi, Tsai, Lyons, Yu, Ouyang, Chen, Chin, Zaal, Chandrasekharappa, P Hanson, Yu, Mullikin, Hasni, Wertz, Ombrello, Stone, Hoffmann et al.: "Loss-of-function mutations in TNFAIP3 leading to A20 haploinsufficiency cause an early-onset autoinflammatory disease. ..." in: Nature genetics, Vol. 48, Issue 1, pp. 67-73, 2015 (Pubmed)
  • Palamarchuk, Efanov, Nazaryan, Santanam, Alder, Rassenti, Kipps, Croce, Pekarsky: "13q14 deletions in CLL involve cooperating tumor suppressors." in: Blood, Vol. 115, Issue 19, pp. 3916-22, 2010 (Pubmed)
Catalog No. ABIN3380443
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TNIP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNFAIP3 Interacting Protein 2 (TNIP2)
NCBI Accession:
NM_024309,NP_077285
Species:
Human
Synonyms:
TNIP2, tnip2.L, tnip2, Tnip2
Insert length:
2250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Charlaftis, Suddason, Wu, Anwar, Karin, Gallagher: "The MEKK1 PHD ubiquitinates TAB1 to activate MAPKs in response to cytokines." in: The EMBO journal, Vol. 33, Issue 21, pp. 2581-96, 2014 (Pubmed)
Catalog No. ABIN3380413
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Norrie Disease (Pseudoglioma) (NDP)
NCBI Accession:
NM_000266,NP_000257
Species:
Human
Synonyms:
NDP, ndp.L, Ndp
Insert length:
1940 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • McNeill, Mazerolle, Bassett, Mears, Ringuette, Lagali, Picketts, Paes, Rice, Wallace: "Hedgehog regulates Norrie disease protein to drive neural progenitor self-renewal." in: Human molecular genetics, Vol. 22, Issue 5, pp. 1005-16, 2013 (Pubmed)
Catalog No. ABIN3382089
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PARG is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
PARG (PARG)
NCBI Accession:
NM_003631,NP_003622
Species:
Human
Synonyms:
PARG, Parg
Insert length:
4420 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Majewski, Thurston, Ramalingam, Kiela, Ghishan: "Cooperative role of NF-{kappa}B and poly(ADP-ribose) polymerase 1 (PARP-1) in the TNF-induced inhibition of PHEX expression in osteoblasts." in: The Journal of biological chemistry, Vol. 285, Issue 45, pp. 34828-38, 2010 (Pubmed)
Catalog No. ABIN3382100
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...
  • ...