Abcd2 (ATP-Binding Cassette, Sub-Family D (ALD), Member 2, Abcd2)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown\; however this protein is speculated to function as a dimerization partner of ABCD1 and/or other peroxisomal ABC transporters. Mutations in this gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008].
More information related to gene Abcd2.
Products related to Abcd2 Gene:
21 Products
Type
  • 21
Species
  • 10
  • 5
  • 4
  • 2
Application
  • 11
  • 8
  • 6
Fusion tag
  • 8
  • 6
  • 4
  • 3
Vector Backbone
  • 6
  • 4
  • 2
  • 2
  • 2
Vector
  • 10
  • 7
  • 4
Insert
  • 8
  • 7
  • 6
Resistance Gene
  • 15
  • 4
  • 2
Expression Type
  • 17
  • 7
Selectable Marker
  • 6
  • 5
Promoter
  • 7
  • 6
  • 4
Format
  • 11
  • 7
  • 3
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998375
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998376
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
526436 (Cow (Bovine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063671
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812624
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812625
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998377
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3998378
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
526436 (Cow (Bovine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063672
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_005164,NP_005155
Species:
Human
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415663
$430.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Species:
Human
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415662
$650.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3474466

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3474465
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3474466

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3797257
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
84356 (Rat (Rattus), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3474466

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN4141658
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_005164,NP_005155
Species:
Human
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415667
$790.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_005164,NP_005155
Species:
Human
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415665
$860.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_033352,NP_203503
Species:
Rat (Rattus)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415664
$980.00
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_033352,NP_203503
Species:
Rat (Rattus)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415668
$1,160.00
10 μg
Plus shipping costs $45.00
Will be delivered in 56 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
NM_033352,NP_203503
Species:
Rat (Rattus)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5415666
$1,270.00
10 μg
Plus shipping costs $45.00
Will be delivered in 56 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3474466

Components:
3 constructs per target plus non-targeting control, each construct delivered in 4 tubes of 25ul
Format:
Viral Particles
Buffer:
High Titer: 1x10^8 TU/mL
Storage:
-80 °C
Catalog No. ABIN3474466
$2,603.00
4 x 100 μL
Plus shipping costs $45.00
Delivery in 21 to 26 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
Synonyms:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3474466

Components:
3 constructs per target plus non-targeting control, each construct delivered in 4 tubes of 25ul
Format:
Viral Particles
Buffer:
High Titer: 1x10^8 TU/mL
Storage:
-80 °C
Catalog No. ABIN3797258
$2,603.00
4 x 100 μL
Plus shipping costs $45.00
Delivery in 21 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Abcd2

  • ATP binding cassette subfamily D member 2 (ABCD2)
  • ABC transporter D family protein (abcD2)
  • ATP-binding cassette sub-family D member 2 (LOC100549247)
  • ATP binding cassette subfamily D member 2 (abcd2)
  • ATP-binding cassette sub-family D member 2 (LOC100640478)
  • ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2)
  • ATP binding cassette subfamily D member 2 (Abcd2)
  • ABC39
  • ALDL1
  • ALDR
  • ALDRP
  • DDBDRAFT_0214891
  • DDBDRAFT_0219834
  • DDB_0214891
  • DDB_0219834
  • hALDR

Gene-IDs for different species

GENE IDSPECIES
466952 Pan troglodytes
477643 Canis lupus familiaris
526436 Bos taurus
8629134 Dictyostelium discoideum AX4
100413459 Callithrix jacchus
100520309 Sus scrofa
417694 Gallus gallus
697556 Macaca mulatta
100019263 Monodelphis domestica
100433322 Pongo abelii
100549247 Meleagris gallopavo
100556516 Anolis carolinensis
100583742 Nomascus leucogenys
100640478 Amphimedon queenslandica
225 Homo sapiens
26874 Mus musculus
84356 Rattus norvegicus

Protein level used designations for Abcd2

  • ATP-binding cassette, sub-family D, member 2
  • ATP-binding cassette, sub-family D (ALD), member 2
  • ATP-binding cassette sub-family D member 2
  • ATP-binding cassette sub-family D member 2-like
  • adrenoleukodystrophy-like 1
  • adrenoleukodystrophy-related protein
  • adrenoleukodystrophy related
Other products related to Abcd2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com