Abcd2 (ATP-Binding Cassette, Sub-Family D (ALD), Member 2, Abcd2)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown\; however this protein is speculated to function as a dimerization partner of ABCD1 and/or other peroxisomal ABC transporters. Mutations in this gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008].
More information related to gene Abcd2.
Products related to Abcd2 Gene:
21 Products
  • 21
  • 10
  • 5
  • 4
  • 2
  • 11
  • 8
  • 6
Fusion tag
  • 8
  • 6
  • 4
  • 3
Vector Backbone
  • 6
  • 4
  • 2
  • 2
  • 2
  • 10
  • 7
  • 4
  • 8
  • 7
  • 6
Resistance Gene
  • 15
  • 4
  • 2
Expression Type
  • 17
  • 7
Selectable Marker
  • 6
  • 5
  • 7
  • 6
  • 4
  • 11
  • 7
  • 3
Supplier: Log in to see

Full length Mus musculus ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3812624
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998375
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Homo sapiens ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998376
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Bos taurus ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
526436 (Cow (Bovine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063671
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3812625
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998377
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Homo sapiens ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3998378
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Bos taurus ATP-binding cassette, sub-family D (ALD), member 2 cDNA clone.

Protein Expression, Cloning
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
526436 (Cow (Bovine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063672
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 2 (ABCD2)

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5415663
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 2 (ABCD2)

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5415662
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Glycerol Stock) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN3797257
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Glycerol Stock) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
84356 (Rat (Rattus), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN4141658
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Glycerol Stock) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
225 (Human, Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 separate shRNA clones and a non-targeting control
Glycerol Stock
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
-80 °C
Catalog No. ABIN3474465
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 2 (ABCD2) , C-term Myc-DDK-tagged

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5415667
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human ATP-binding cassette, sub-family D (ALD), member 2 (ABCD2) , C-term GFP tagged

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2223 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5415665
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Rat ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2)

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
Rat (Rattus)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5415664
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Rat ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2) , C-term Myc-DDK-tagged

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
Rat (Rattus)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5415668
10 μg
Plus shipping costs $45.00
Will be delivered in 56 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Rat ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2) , C-term GFP tagged

Protein Expression
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
NCBI Accession:
Rat (Rattus)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Insert length:
2226 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:
GFP tag

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5415666
10 μg
Plus shipping costs $45.00
Will be delivered in 56 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Viral Particles 100 μl - 1x10^8 TU/ml) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
26874 (Mouse (Murine), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 constructs per target plus non-targeting control, each construct delivered in 4 tubes of 25ul
Viral Particles
High Titer: 1x10^8 TU/mL
-80 °C
Catalog No. ABIN3797258
4 x 100 μL
Plus shipping costs $45.00
Delivery in 21 to 26 Business Days
Supplier: Log in to see

shERWOOD-UltramiR shRNA Lentiviral Target Gene Set in pZIP-mCMV-ZsGreen (Viral Particles 100 μl - 1x10^8 TU/ml) for fast and most complete knockdown.

RNA Interference
ATP-Binding Cassette, Sub-Family D (ALD), Member 2 (Abcd2)
Gene ID:
84356 (Rat (Rattus), Abcd2)
ABCD2, abcD2, LOC100549247, abcd2, LOC100640478, Abcd2
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
mCMV Promoter
Fusion Tag:
Transient, Stable

Empty vector controls:
Viral particles:

3 constructs per target plus non-targeting control, each construct delivered in 4 tubes of 25ul
Viral Particles
High Titer: 1x10^8 TU/mL
-80 °C
Catalog No. ABIN4141659
4 x 100 μL
Plus shipping costs $45.00
Delivery in 21 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Abcd2

  • ATP binding cassette subfamily D member 2 (ABCD2)
  • ABC transporter D family protein (abcD2)
  • ATP-binding cassette sub-family D member 2 (LOC100549247)
  • ATP binding cassette subfamily D member 2 (abcd2)
  • ATP-binding cassette sub-family D member 2 (LOC100640478)
  • ATP-binding cassette, sub-family D (ALD), member 2 (Abcd2)
  • ATP binding cassette subfamily D member 2 (Abcd2)
  • ABC39
  • ALDL1
  • ALDR
  • DDBDRAFT_0214891
  • DDBDRAFT_0219834
  • DDB_0214891
  • DDB_0219834
  • hALDR

Gene-IDs for different species

466952 Pan troglodytes
477643 Canis lupus familiaris
526436 Bos taurus
8629134 Dictyostelium discoideum AX4
100413459 Callithrix jacchus
100520309 Sus scrofa
417694 Gallus gallus
697556 Macaca mulatta
100019263 Monodelphis domestica
100433322 Pongo abelii
100549247 Meleagris gallopavo
100556516 Anolis carolinensis
100583742 Nomascus leucogenys
100640478 Amphimedon queenslandica
225 Homo sapiens
26874 Mus musculus
84356 Rattus norvegicus

Protein level used designations for Abcd2

  • ATP-binding cassette, sub-family D, member 2
  • ATP-binding cassette, sub-family D (ALD), member 2
  • ATP-binding cassette sub-family D member 2
  • ATP-binding cassette sub-family D member 2-like
  • adrenoleukodystrophy-like 1
  • adrenoleukodystrophy-related protein
  • adrenoleukodystrophy related
Other products related to Abcd2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website