CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

154,625 Products
Data Quality
  • 4
Type
  • 154625
    Plasmid
Gene
  • 39
  • 18
  • 18
  • 18
  • 18
Species
  • 61109
  • 60922
  • 32526
  • 58
  • 8
Insert
  • 785880
  • 437352
  • 365415
  • 154625
    gRNA + Cas9
  • 114972
Vector
  • 115481
  • 39144
Vector Backbone
  • 115473
  • 39144
  • 1
  • 1
  • 1
Fusion tag
  • 115477
  • 39144
  • 2
  • 2
Resistance Gene
  • 154625
Selectable Marker
  • 115476
  • 1
Promoter
  • 154617
  • 115473
  • 39144
Expression Type
  • 154625
  • 115478
Application
  • 154625
  • 115473
  • 8
Format
  • 115473
  • 39144
  • 8
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia (PML)
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1 (TMX1)
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Gata6 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GATA Binding Protein 6 (GATA6)
Species:
Mouse (Murine)
Synonyms:
GATA6, Gata6, gata6, gata6.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Gata6 gRNA vector 1 in pCAS-Guide vector.
  • Gata6 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235676
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GBF1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Golgi Brefeldin A Resistant Guanine Nucleotide Exchange Factor 1 (GBF1)
Species:
Human
Synonyms:
GBF1, LOC100185387, gbf1, Gbf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GBF1 gRNA vector 1 in pCAS-Guide vector.
  • GBF1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235702
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Gbx1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Gastrulation Brain Homeobox 1 (GBX1)
Species:
Mouse (Murine)
Synonyms:
GBX1, Gbx1, gbx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Gbx1 gRNA vector 1 in pCAS-Guide vector.
  • Gbx1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235725
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GFPT2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Glutamine-Fructose-6-Phosphate Transaminase 2 (GFPT2)
Species:
Human
Synonyms:
gfpt2.L, GFPT2, gfpt2, Gfpt2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GFPT2 gRNA vector 1 in pCAS-Guide vector.
  • GFPT2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235865
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GFRA1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GDNF Family Receptor alpha 1 (GFRA1)
Species:
Human
Synonyms:
gfra1, GFRA1, Gfra1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GFRA1 gRNA vector 1 in pCAS-Guide vector.
  • GFRA1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235867
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GCC1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GRIP and Coiled-Coil Domain Containing 1 (GCC1)
Species:
Human
Synonyms:
Gcc1, GCC1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GCC1 gRNA vector 1 in pCAS-Guide vector.
  • GCC1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235734
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GBP5 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Guanylate Binding Protein 5 (GBP5)
Species:
Human
Synonyms:
GBP5, gbp5, LOC100469548, Gbp5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GBP5 gRNA vector 1 in pCAS-Guide vector.
  • GBP5 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235716
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GCLC via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Glutamate-Cysteine Ligase, Catalytic Subunit (GCLC)
Species:
Human
Synonyms:
GCLC, gclc, Gclc, LbGCS, gcsA, gclc.L, gclc.S, GSH1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GCLC gRNA vector 1 in pCAS-Guide vector.
  • GCLC gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235755
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GALR1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Galanin Receptor 1 (GALR1)
Species:
Human
Synonyms:
GALR1, galr1, galR, galR1, Galr1, LOC100037697
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GALR1 gRNA vector 1 in pCAS-Guide vector.
  • GALR1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235609
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GH2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Growth Hormone 2 (GH2)
Species:
Human
Synonyms:
GH2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GH2 gRNA vector 1 in pCAS-Guide vector.
  • GH2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235911
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GART via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Phosphoribosylglycinamide Formyltransferase (GART)
Species:
Human
Synonyms:
Gart
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GART gRNA vector 1 in pCAS-Guide vector.
  • GART gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235645
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GAS2L1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Growth Arrest-Specific 2 Like 1 (GAS2L1)
Species:
Human
Synonyms:
GAS2L1, Gas2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GAS2L1 gRNA vector 1 in pCAS-Guide vector.
  • GAS2L1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235651
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GATA2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GATA Binding Protein 2 (GATA2)
Species:
Human
Synonyms:
GATA2, RR_RS20245, gatA2, Gata2, Smp_018590, gata2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GATA2 gRNA vector 1 in pCAS-Guide vector.
  • GATA2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235667
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human GIPC2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GIPC PDZ Domain Containing Family, Member 2 (GIPC2)
Species:
Human
Synonyms:
GIPC2, Gipc2, gipc2, gipc2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GIPC2 gRNA vector 1 in pCAS-Guide vector.
  • GIPC2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235968
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GIT2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
G Protein-Coupled Receptor Kinase Interactor 2 (GIT2)
Species:
Human
Synonyms:
GIT2, git2, git2a, Git2, git2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GIT2 gRNA vector 1 in pCAS-Guide vector.
  • GIT2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235976
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GEM via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GTP Binding Protein Overexpressed in Skeletal Muscle (GEM)
Species:
Human
Synonyms:
GEM, gem, Gem
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GEM gRNA vector 1 in pCAS-Guide vector.
  • GEM gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235829
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human GBA via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Glucosidase, Beta, Acid (GBA)
Species:
Human
Synonyms:
GBA, BGLU25, PSPTO_3318, bglX, bglA4, Gba, LOC100399524, bglA.2, bglX-2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GBA gRNA vector 1 in pCAS-Guide vector.
  • GBA gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235693
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human GFRA2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
GDNF Family Receptor alpha 2 (GFRA2)
Species:
Human
Synonyms:
DKFZP459C0228, gfra2, gfra2a, GFRA2, Gfra2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • GFRA2 gRNA vector 1 in pCAS-Guide vector.
  • GFRA2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3235869
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...