CRISPR/ Cas9 Vectors

Here you can find our complete kits for gene knockout via CRISPR. All products are designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Components of all CRISPR/ Cas9 kits: 2 guide-RNA vectors to ensure an efficient cleavage. Donor vector containing left and right homologous arms and GFP-Puro functional cassette. Scramble sequence in pCas-Guide vector as negative control.

Browse our high-quality products. For more detailed information regarding a product please download the datasheet. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

154,625 Products
Data Quality
  • 4
Type
  • 154625
    Plasmid
Gene
  • 39
  • 18
  • 18
  • 18
  • 18
Species
  • 61109
  • 60922
  • 32526
  • 58
  • 8
Insert
  • 785880
  • 437352
  • 365415
  • 154625
    gRNA + Cas9
  • 114972
Vector
  • 115481
  • 39144
Vector Backbone
  • 115473
  • 39144
  • 1
  • 1
  • 1
Fusion tag
  • 115477
  • 39144
  • 2
  • 2
Resistance Gene
  • 154625
Selectable Marker
  • 115476
  • 1
Promoter
  • 154617
  • 115473
  • 39144
Expression Type
  • 154625
  • 115478
Application
  • 154625
  • 115473
  • 8
Format
  • 115473
  • 39144
  • 8
Supplier: Log in to see

Knockout Kit for Human PML via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Promyelocytic Leukemia (PML)
Species:
Human
Synonyms:
PML, Pml
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • PML gRNA vector 1 in pCAS-Guide vector.
  • PML gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Xu, Mallon, Roizman: "PML plays both inimical and beneficial roles in HSV-1 replication." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 113, Issue 21, pp. E3022-8, 2016 (Pubmed)
Catalog No. ABIN3231147
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human TMX1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Thioredoxin-Related Transmembrane Protein 1 (TMX1)
Species:
Human
Synonyms:
TMX1, Tmx1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • TMX1 gRNA vector 1 in pCAS-Guide vector.
  • TMX1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Raturi, Gutiérrez, Ortiz-Sandoval, Ruangkittisakul, Herrera-Cruz, Rockley, Gesson, Ourdev, Lou, Lucchinetti, Tahbaz, Zaugg, Baksh, Ballanyi, Simmen: "TMX1 determines cancer cell metabolism as a thiol-based modulator of ER-mitochondria Ca2+ flux." in: The Journal of cell biology, Vol. 214, Issue 4, pp. 433-44, 2016 (Pubmed)
Catalog No. ABIN3258143
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Knockout Kit for Human SERGEF via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Secretion Regulating Guanine Nucleotide Exchange Factor (SERGEF)
Species:
Human
Synonyms:
SERGEF, TPH1, sergef, Sergef
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SERGEF gRNA vector 1 in pCAS-Guide vector.
  • SERGEF gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226720
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SERHL via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
serine Hydrolase-Like (SERHL)
Species:
Human
Synonyms:
serhl, RRP7A, serhl2.S, SERHL2, Serhl2, serhl2, SERHL, Serhl
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SERHL gRNA vector 1 in pCAS-Guide vector.
  • SERHL gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226722
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SERINC2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
serine Incorporator 2 (SERINC2)
Species:
Human
Synonyms:
SERINC2, Serinc2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SERINC2 gRNA vector 1 in pCAS-Guide vector.
  • SERINC2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226727
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RSPRY1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Ring Finger and SPRY Domain Containing 1 (RSPRY1)
Species:
Human
Synonyms:
RSPRY1, rspry1, rspry1.S, Rspry1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RSPRY1 gRNA vector 1 in pCAS-Guide vector.
  • RSPRY1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3225971
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human RSRC2 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
arginine/serine-Rich Coiled-Coil 2 (RSRC2)
Species:
Human
Synonyms:
RSRC2, LOC100359524, rsrc2.L, Rsrc2, rsrc2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • RSRC2 gRNA vector 1 in pCAS-Guide vector.
  • RSRC2 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3225975
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SERPINA12 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
serpin Peptidase Inhibitor, Clade A (Alpha-1 Antiproteinase, Antitrypsin), Member 12 (SERPINA12)
Species:
Human
Synonyms:
SERPINA12, Serpina12, LOC612386
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SERPINA12 gRNA vector 1 in pCAS-Guide vector.
  • SERPINA12 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226744
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SERPINB1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
serpin Peptidase Inhibitor, Clade B (Ovalbumin), Member 1 (SERPINB1)
Species:
Human
Synonyms:
SERPINB1, serpinb1, serpinb1l1, Serpinb1a, serpinb1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SERPINB1 gRNA vector 1 in pCAS-Guide vector.
  • SERPINB1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226771
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Sertad1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SERTA Domain Containing 1 (SERTAD1)
Species:
Mouse (Murine)
Synonyms:
sertad1.L, SERTAD1, Sertad1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Sertad1 gRNA vector 1 in pCAS-Guide vector.
  • Sertad1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226833
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SESN1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sestrin 1 (SESN1)
Species:
Human
Synonyms:
SESN1, sesn1, Sesn1, sesn1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SESN1 gRNA vector 1 in pCAS-Guide vector.
  • SESN1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226842
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SET via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SET
Species:
Human
Synonyms:
SET
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SET gRNA vector 1 in pCAS-Guide vector.
  • SET gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226850
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SETBP1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SET Binding Protein 1 (SETBP1)
Species:
Human
Synonyms:
SETBP1, Setbp1, setbp1, LOC100080512, NI36_RS04255
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SETBP1 gRNA vector 1 in pCAS-Guide vector.
  • SETBP1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226852
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SGPL1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sphingosine-1-Phosphate Lyase 1 (SGPL1)
Species:
Human
Synonyms:
SGPL1, sgpl1.L, sgpl1, Sgpl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SGPL1 gRNA vector 1 in pCAS-Guide vector.
  • SGPL1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226988
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Sall4 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sal-Like 4 (Drosophila) (SALL4)
Species:
Mouse (Murine)
Synonyms:
SALL4, sall4, sall4.L, Sall4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Sall4 gRNA vector 1 in pCAS-Guide vector.
  • Sall4 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226168
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SH2D1B via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SH2 Domain Containing 1B (SH2D1B)
Species:
Human
Synonyms:
Sh2d1b, SH2D1B, Sh2d1b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SH2D1B gRNA vector 1 in pCAS-Guide vector.
  • SH2D1B gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3227013
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SH2D4A via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SH2 Domain Containing 4A (SH2D4A)
Species:
Human
Synonyms:
SH2D4A, sh2d4a, Sh2d4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SH2D4A gRNA vector 1 in pCAS-Guide vector.
  • SH2D4A gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3227021
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SATB1 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SATB Homeobox 1 (SATB1)
Species:
Human
Synonyms:
SATB1, satb1, Satb1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SATB1 gRNA vector 1 in pCAS-Guide vector.
  • SATB1 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226249
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SHARPIN via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
SHANK-Associated RH Domain Interacting Protein (SHARPIN)
Species:
Human
Synonyms:
Sharpin, SHARPIN
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SHARPIN gRNA vector 1 in pCAS-Guide vector.
  • SHARPIN gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3227086
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Knockout Kit for Human SIGLEC8 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Sialic Acid Binding Ig-Like Lectin 8 (SIGLEC8)
Species:
Human
Synonyms:
SIGLEC8, LOC506364
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • SIGLEC8 gRNA vector 1 in pCAS-Guide vector.
  • SIGLEC8 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3227181
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...