cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
585,859 Products
Data Quality
  • 2024
Type
  • 585859
    Plasmid
Gene
  • 222
  • 209
  • 202
  • 150
  • 149
Species
  • 236621
  • 194127
  • 153712
  • 506
  • 266
Insert
  • 585859
    cDNA
  • 397475
  • 215849
  • 154617
  • 114972
Vector
  • 323142
  • 247251
  • 9413
  • 6053
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62461
  • 61225
Fusion tag
  • 91226
  • 187387
  • 62461
  • 61225
  • 61224
Resistance Gene
  • 548937
  • 36922
Selectable Marker
  • 305724
  • 1
Promoter
  • 264113
  • 247372
  • 75770
  • 803
Expression Type
  • 323196
  • 247196
  • 4215
Application
  • 323142
  • 262717
Supplier: Log in to see

Untagged full-length cDNA clone from Human SSBP1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Single-Stranded DNA Binding Protein 1 (SSBP1)
NCBI Accession:
NM_003143,NP_003134
Species:
Human
Synonyms:
SSBP1, Ssbp1, ssbp1, SSB, NABP2, Nabp2, nabp2, LOC100357130
Insert length:
690 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Qian, Ziehr, Johnson: "Alpers disease mutations in human DNA polymerase gamma cause catalytic defects in mitochondrial DNA replication by distinct mechanisms." in: Frontiers in genetics, Vol. 6, Issue , pp. 135, 2015 (Pubmed)
Catalog No. ABIN3380172
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GTPBP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
GTP Binding Protein 2 (GTPBP2)
NCBI Accession:
NM_019096,NP_061969
Species:
Human
Synonyms:
GTPBP2, Gtpbp2, gbp2
Insert length:
2870 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jaberi, Rohani, Shahidi, Nafissi, Arefian, Soleimani, Rasooli, Ahmadieh, Daftarian, KaramiNejadRanjbar, Klotzle, Fan, Turk, Steemers, Elahi: "Identification of mutation in GTPBP2 in patients of a family with neurodegeneration accompanied by iron deposition in the brain." in: Neurobiology of aging, Vol. 38, Issue , pp. 216.e11-8, 2016 (Pubmed)
Catalog No. ABIN3384347
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Mog is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Oligodendrocyte Myelin Glycoprotein (OMG)
NCBI Accession:
NP_034944
Species:
Mouse (Murine)
Synonyms:
MOG, OMG, Mog, mog, LOC100400400, Omg, omg, LOC100353276
Insert length:
744 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Brentville, Metheringham, Gunn, Symonds, Daniels, Gijon, Cook, Xue, Durrant: "Citrullinated Vimentin Presented on MHC-II in Tumor Cells Is a Target for CD4+ T-Cell-Mediated Antitumor Immunity." in: Cancer research, Vol. 76, Issue 3, pp. 548-60, 2016 (Pubmed)
Catalog No. ABIN3330736
$490.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GPX4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Glutathione Peroxidase (GPX4)
NCBI Accession:
NM_002085,NP_002076
Species:
Human
Synonyms:
GPX4, Gpx4, gpx4a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Agbor, Demma, Mrsny, Castillo, Boll, McCormick: "The oxido-reductase enzyme glutathione peroxidase 4 (GPX4) governs Salmonella Typhimurium-induced neutrophil transepithelial migration." in: Cellular microbiology, Vol. 16, Issue 9, pp. 1339-53, 2014 (Pubmed)
Catalog No. ABIN3316881
$390.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CRYZ is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Crystallin, zeta (CRYZ)
NCBI Accession:
NM_001889,NP_001880
Species:
Human
Synonyms:
CRYZ, LOC733653, cryz, PTRG_02583, PTRG_07455, VDBG_03981, Cryz
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3383469
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Fabp5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Epidermal Fatty Acid Binding Protein 5
NCBI Accession:
NM_001272098,NP_001259027
Species:
Mouse (Murine)
Insert length:
222 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292227
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Fabp5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Epidermal Fatty Acid Binding Protein 5
NCBI Accession:
NM_001272097,NP_001259026
Species:
Mouse (Murine)
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3292228
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VANGL1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Vang-Like 1 (Van Gogh, Drosophila) (Vangl1)
NCBI Accession:
NM_138959,NP_620409
Species:
Human
Synonyms:
Vangl1, vangl1, VANGL1
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3387668
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Calca is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
CALCA
NCBI Accession:
NM_001289444,NP_001276373
Species:
Mouse (Murine)
Insert length:
387 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3294526
$190.00
1 kit
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Gpx4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Glutathione Peroxidase (GPX4)
NCBI Accession:
NM_001037741,NP_001032830
Species:
Mouse (Murine)
Synonyms:
GPX4, Gpx4, gpx4a
Insert length:
762 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3324206
$390.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Gpx4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Glutathione Peroxidase (GPX4)
NCBI Accession:
NM_008162,NP_032188
Species:
Mouse (Murine)
Synonyms:
GPX4, Gpx4, gpx4a
Insert length:
594 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3324207
$390.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) D17Wsu104e is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
DNA segment, Chr 17, Wayne State University 104, expressed (D17Wsu104e)
NCBI Accession:
NM_080837,NP_543027
Species:
Mouse (Murine)
Synonyms:
D17Wsu104e
Insert length:
501 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3298149
$390.00
1 kit
Plus shipping costs $45.00 Will be delivered in 16 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SMG7 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Smg-7 Homolog, Nonsense Mediated mRNA Decay Factor (C. Elegans) (SMG7)
NCBI Accession:
NM_014837,NP_055652
Species:
Human
Synonyms:
Smg7, SMG7
Insert length:
3550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3386844
$600.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PDE5A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
phosphodiesterase 5A, cGMP-Specific (PDE5A)
NCBI Accession:
NM_001083,NP_001074
Species:
Human
Synonyms:
PDE5A, pde5a, pde5ab, Pde5a, PDE5
Insert length:
8000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3379342
$700.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PDE5A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
phosphodiesterase 5A, cGMP-Specific (PDE5A)
NCBI Accession:
NM_001083,NP_001074
Species:
Human
Synonyms:
PDE5A, pde5a, pde5ab, Pde5a, PDE5
Insert length:
5500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3379340
$700.00
1 kit
Plus shipping costs $45.00 Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Cdh16 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cadherin-16 (CDH16)
NCBI Accession:
NM_001252627,NP_001239556
Species:
Mouse (Murine)
Synonyms:
CDH16, CDH17, Cdh16
Insert length:
2403 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3295693
$740.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Cdh16 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cadherin-16 (CDH16)
NCBI Accession:
NM_001252628,NP_001239557
Species:
Mouse (Murine)
Synonyms:
CDH16, CDH17, Cdh16
Insert length:
2448 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3295694
$750.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Zfp27 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Zinc Finger Protein 27 (ZFP27)
NCBI Accession:
NM_001285797,NP_001272726
Species:
Mouse (Murine)
Synonyms:
Zfp27
Insert length:
2460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376419
$760.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Zfp27 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Zinc Finger Protein 27 (ZFP27)
NCBI Accession:
NM_001285798,NP_001272727
Species:
Mouse (Murine)
Synonyms:
Zfp27
Insert length:
2460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376420
$760.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Mouse (Murine) Zfp27 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Zinc Finger Protein 27 (ZFP27)
NCBI Accession:
NM_011754,NP_035884
Species:
Mouse (Murine)
Synonyms:
Zfp27
Insert length:
2460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient
Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376421
$760.00
1 kit
Plus shipping costs $45.00 Will be delivered in 21 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...