cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,882 Products
Data Quality
  • 2024
Type
  • 785882
    Plasmid
Gene
  • 232
  • 226
  • 209
  • 165
  • 163
Species
  • 284091
  • 247446
  • 167151
  • 27699
  • 21907
Insert
  • 785882
    cDNA
  • 437353
  • 365420
  • 154625
  • 114972
Vector
  • 442103
  • 247251
  • 87095
  • 9413
  • 20
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62461
  • 61225
Fusion tag
  • 291239
  • 187387
  • 62461
  • 61225
  • 61224
Resistance Gene
  • 563554
  • 199160
  • 23502
Selectable Marker
  • 335060
  • 14372
  • 62
  • 5
  • 1
Promoter
  • 264113
  • 247372
  • 182022
  • 9106
  • 803
Expression Type
  • 438771
  • 247428
  • 4227
  • 3174
  • 10
Application
  • 462721
  • 442123
  • 20
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
NM_001730,NP_001721
Species:
Human
Synonyms:
KLF5, klf5.S, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
NM_021972,NP_068807
Species:
Human
Synonyms:
Sk1, SPHK1, sphk1.L, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KCNIP4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kv Channel Interacting Protein 4 (KCNIP4)
NCBI Accession:
NM_025221,NP_079497
Species:
Human
Synonyms:
KCNIP4, kcnip4.L, Kcnip4
Insert length:
2340 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Venn, Haynes, Burgoyne: "Specific effects of KChIP3/calsenilin/DREAM, but not KChIPs 1, 2 and 4, on calcium signalling and regulated secretion in PC12 cells." in: The Biochemical journal, Vol. 413, Issue 1, pp. 71-80, 2008 (Pubmed)
Catalog No. ABIN3384713
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NFYC is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nuclear Transcription Factor Y, gamma (NFYC)
NCBI Accession:
NM_014223,NP_055038
Species:
Human
Synonyms:
NFYC, nfyc, nfyc.L, Nfyc
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Morachis, Murawsky, Emerson: "Regulation of the p53 transcriptional response by structurally diverse core promoters." in: Genes & development, Vol. 24, Issue 2, pp. 135-47, 2010 (Pubmed)
Catalog No. ABIN3385441
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human POT1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Protection of Telomeres 1 Homolog (S. Pombe) (POT1)
NCBI Accession:
NM_015450,NP_056265
Species:
Human
Synonyms:
POT1, pot1.L, Pot1a, Pot1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Robles-Espinoza, Harland, Ramsay, Aoude, Quesada, Ding, Pooley, Pritchard, Tiffen, Petljak, Palmer, Symmons, Johansson, Stark, Gartside, Snowden, Montgomery, Martin, Liu, Choi, Makowski, Brown et al.: "POT1 loss-of-function variants predispose to familial melanoma. ..." in: Nature genetics, Vol. 46, Issue 5, pp. 478-81, 2014 (Pubmed)
Catalog No. ABIN3385950
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ERRFI1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ERBB Receptor Feedback Inhibitor 1 (ERRFI1)
NCBI Accession:
NM_018948,NP_061821
Species:
Human
Synonyms:
ERRFI1, Errfi1, errfi1.S, errfi1a, errfi1, errfi
Insert length:
3100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lin, Du, Shen, Whang, Donner, Griff, He, Moore, Clark, Ruan: "Mitogen-inducible gene-6 is a multifunctional adaptor protein with tumor suppressor-like activity in papillary thyroid cancer." in: The Journal of clinical endocrinology and metabolism, Vol. 96, Issue 3, pp. E554-65, 2011 (Pubmed)
Catalog No. ABIN3377930
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human FBXO7 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
F-Box Protein 7 (FBXO7)
NCBI Accession:
NM_012179,NP_036311
Species:
Human
Synonyms:
FBXO7, fbxo7.L, fbxo7, FBP7, Fbxo7
Insert length:
2040 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhou, Xie, Sathiyamoorthy, Saw, Sing, Ng, Chua, Tang, Shaffra, Li, Wang, Ho, Lai, Angeles, Lim, Tan: "F-box protein 7 mutations promote protein aggregation in mitochondria and inhibit mitophagy." in: Human molecular genetics, Vol. 24, Issue 22, pp. 6314-30, 2015 (Pubmed)
Catalog No. ABIN3384057
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX18 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 18 (SOX18)
NCBI Accession:
NM_018419,NP_060889
Species:
Human
Synonyms:
SOX18, Sox18
Insert length:
1750 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, SP6 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948185

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Gross, Aggarwal, Kumar, Tian, Kasa, Bogatcheva, Datar, Verin, Fineman, Black: "Sox18 preserves the pulmonary endothelial barrier under conditions of increased shear stress." in: Journal of cellular physiology, Vol. 229, Issue 11, pp. 1802-16, 2014 (Pubmed)
Catalog No. ABIN3393818
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PDPN is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Podoplanin (PDPN)
NCBI Accession:
NM_006474,NP_006465
Species:
Human
Synonyms:
PDPN, Pdpn
Insert length:
3000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kim, Rha, Shim, Kim, Kim, Huang, Koo: "Podoplanin is involved in the prognosis of head and neck squamous cell carcinoma through interaction with VEGF-C." in: Oncology reports, Vol. 34, Issue 2, pp. 833-42, 2015 (Pubmed)
  • Cueni, Hegyi, Shin, Albinger-Hegyi, Gruber, Kunstfeld, Moch, Detmar: "Tumor lymphangiogenesis and metastasis to lymph nodes induced by cancer cell expression of podoplanin." in: The American journal of pathology, Vol. 177, Issue 2, pp. 1004-16, 2010 (Pubmed)
  • Schacht, Dadras, Johnson, Jackson, Hong, Detmar: "Up-regulation of the lymphatic marker podoplanin, a mucin-type transmembrane glycoprotein, in human squamous cell carcinomas and germ cell tumors." in: The American journal of pathology, Vol. 166, Issue 3, pp. 913-21, 2005 (Pubmed)
Catalog No. ABIN3385741
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human GLI1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Zinc Finger Protein GLI1 (GLI1)
NCBI Accession:
NM_005269,NP_005260
Species:
Human
Synonyms:
GLI1, Gli1, gli1.S, gli1
Insert length:
3600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Calvisi, Pinna, Ladu, Pellegrino, Simile, Frau, De Miglio, Tomasi, Sanna, Muroni, Feo, Pascale: "Forkhead box M1B is a determinant of rat susceptibility to hepatocarcinogenesis and sustains ERK activity in human HCC." in: Gut, Vol. 58, Issue 5, pp. 679-87, 2009 (Pubmed)
Catalog No. ABIN3384227
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VIP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Vasoactive Intestinal Peptide (Vip)
NCBI Accession:
NM_194435,NP_919416
Species:
Human
Synonyms:
VIP, vip.L, vip, vipb, Vip
Insert length:
1470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tee, Marshall, Liu, Xu, Haber, Norris, Iismaa, Liu: "Opposing effects of two tissue transglutaminase protein isoforms in neuroblastoma cell differentiation." in: The Journal of biological chemistry, Vol. 285, Issue 6, pp. 3561-7, 2010 (Pubmed)
Catalog No. ABIN3387686
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PSMC5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5 (PSMC5)
NCBI Accession:
NM_002805,NP_002796
Species:
Human
Synonyms:
Psmc5, PSMC5, psmc5, psmc5.L, psmc5.S
Insert length:
1430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chen, Laurenzana, Coslo, Chen, Omiecinski: "Proteasomal interaction as a critical activity modulator of the human constitutive androstane receptor." in: The Biochemical journal, Vol. 458, Issue 1, pp. 95-107, 2014 (Pubmed)
Catalog No. ABIN3386114
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NR1D1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Nuclear Receptor Subfamily 1, Group D, Member 1 (NR1D1)
NCBI Accession:
NM_021724,NP_068370
Species:
Human
Synonyms:
nr1d1.L, nr1d1, NR1D1, Nr1d1
Insert length:
2770 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chandra, Mahajan, Saini, Dkhar, Nanduri, Raj, Kumar, Gupta: "Human IL10 gene repression by Rev-erbα ameliorates Mycobacterium tuberculosis clearance." in: The Journal of biological chemistry, Vol. 288, Issue 15, pp. 10692-702, 2013 (Pubmed)
Catalog No. ABIN3385502
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RHOC is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ras Homolog Gene Family, Member C (RHOC)
NCBI Accession:
NM_175744,NP_786886
Species:
Human
Synonyms:
rhoc.L, RHOC, rhoc, Rhoc
Insert length:
1140 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Quinn, Brindley, Weller, Kaludov, Kondratowicz, Hunt, Sinn, McCray, Stein, Davidson, Flick, Mandell, Staplin, Maury, Chiorini: "Rho GTPases modulate entry of Ebola virus and vesicular stomatitis virus pseudotyped vectors." in: Journal of virology, Vol. 83, Issue 19, pp. 10176-86, 2009 (Pubmed)
Catalog No. ABIN3386371
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PTBP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Polypyrimidine Tract Binding Protein 2 (PTBP2)
NCBI Accession:
NM_021190,NP_067013
Species:
Human
Synonyms:
PTBP2, Ptbp2, ptbp2b
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yip, Fuhlbrigge, Taylor, Creusot, Nishikawa-Matsumura, Whiting, Schartner, Akter, von Herrath, Fathman: "Inflammation and hyperglycemia mediate Deaf1 splicing in the pancreatic lymph nodes via distinct pathways during type 1 diabetes." in: Diabetes, Vol. 64, Issue 2, pp. 604-17, 2015 (Pubmed)
Catalog No. ABIN3386141
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SLC22A2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 22 (Organic Cation Transporter), Member 2 (SLC22A2)
NCBI Accession:
NM_003058,NP_003049
Species:
Human
Synonyms:
POU2F2, SLC22A2, LOC521027, Slc22a2
Insert length:
2400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Sun, Li, Tu, Jiang: "Involvement of organic cation transporter 2 inhibition in potential mechanisms of antidepressant action." in: Progress in neuro-psychopharmacology & biological psychiatry, Vol. 53, Issue , pp. 90-8, 2014 (Pubmed)
  • Sprowl, Ciarimboli, Lancaster, Giovinazzo, Gibson, Du, Janke, Cavaletti, Shields, Sparreboom: "Oxaliplatin-induced neurotoxicity is dependent on the organic cation transporter OCT2." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 110, Issue 27, pp. 11199-204, 2013 (Pubmed)
  • Filipski, Loos, Verweij, Sparreboom: "Interaction of Cisplatin with the human organic cation transporter 2." in: Clinical cancer research : an official journal of the American Association for Cancer Research, Vol. 14, Issue 12, pp. 3875-80, 2008 (Pubmed)
Catalog No. ABIN3386748
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCNN1B is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sodium Channel, Nonvoltage-Gated 1, beta (SCNN1B)
NCBI Accession:
NM_000336,NP_000327
Species:
Human
Synonyms:
SCNN1B, scnn1b, Scnn1b
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kim, Son, Kim, Kweon, Suh, Lyall, Rhyu: "Selective activation of hTRPV1 by N-geranyl cyclopropylcarboxamide, an amiloride-insensitive salt taste enhancer." in: PLoS ONE, Vol. 9, Issue 2, pp. e89062, 2014 (Pubmed)
  • Araki, Umemura, Miyagi, Yabana, Miki, Tamura, Uchino, Aoki, Goshima, Umemura, Ishigami: "Expression, transcription, and possible antagonistic interaction of the human Nedd4L gene variant: implications for essential hypertension." in: Hypertension (Dallas, Tex. : 1979), Vol. 51, Issue 3, pp. 773-7, 2008 (Pubmed)
Catalog No. ABIN3379906
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LCAT is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lecithin-Cholesterol Acyltransferase (LCAT)
NCBI Accession:
NM_000229,NP_000220
Species:
Human
Synonyms:
LCAT, Lcat, lcat.L, lcat, SLC12A4, FRA13A
Insert length:
1400 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Rousset, Vaisman, Auerbach, Krause, Homan, Stonik, Csako, Shamburek, Remaley: "Effect of recombinant human lecithin cholesterol acyltransferase infusion on lipoprotein metabolism in mice." in: The Journal of pharmacology and experimental therapeutics, Vol. 335, Issue 1, pp. 140-8, 2010 (Pubmed)
Catalog No. ABIN3376773
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CDK9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cyclin-Dependent Kinase 9 (CDK9)
NCBI Accession:
NM_001261,NP_001252
Species:
Human
Synonyms:
CDK9, cdk9, Cdk9, cdk9.S
Insert length:
1910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sayed, Yang, He, Pfleger, Abdellatif: "Acute targeting of general transcription factor IIB restricts cardiac hypertrophy via selective inhibition of gene transcription." in: Circulation. Heart failure, Vol. 8, Issue 1, pp. 138-48, 2015 (Pubmed)
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
  • Ma, Chen, Wright, Pillai, Chellappan, Cress: "CDKN1C negatively regulates RNA polymerase II C-terminal domain phosphorylation in an E2F1-dependent manner." in: The Journal of biological chemistry, Vol. 285, Issue 13, pp. 9813-22, 2010 (Pubmed)
Catalog No. ABIN3383219
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCAMP5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Secretory Carrier Membrane Protein 5 (SCAMP5)
NCBI Accession:
NM_138967,NP_620417
Species:
Human
Synonyms:
scamp5a, SCAMP5, LOC493330, Scamp5, SCAMP2
Insert length:
3800 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Noh, Lee, Song, Kim, Im, Kim, Seo, Chung, Chang, Ferrante, Yoo, Ryu, Jung: "SCAMP5 links endoplasmic reticulum stress to the accumulation of expanded polyglutamine protein aggregates via endocytosis inhibition." in: The Journal of biological chemistry, Vol. 284, Issue 17, pp. 11318-25, 2009 (Pubmed)
Catalog No. ABIN3379901
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...