cDNA Clones

Complementary DNA or in short cDNA is the product of reverse transcription from an RNA template. Typically, mRNA serves as template for the generation of a cDNA in which its poly-(A) tail is used as a primer site for reverse transcriptase. Subsequently, the cDNA product is amplified by PCR. Usually cDNA does not contain any introns and corresponds oftentimes to the actual coding sequence of gene. As such, cDNA is an important intermediate on the way to expressing a protein of interest. A complete cDNA library of a given organism represents its transcriptome. Derived from mRNA and including 5’ and 3’ UTRs, our cDNA collections are ideal for overexpressing a gene in the context of native regulation.
785,880 Products
Data Quality
  • 2024
Type
  • 785880
    Plasmid
Gene
  • 232
  • 226
  • 209
  • 165
  • 163
Species
  • 284089
  • 247446
  • 167151
  • 27699
  • 21907
Insert
  • 785880
    cDNA
  • 437352
  • 365415
  • 154625
  • 114972
Vector
  • 441085
  • 247251
  • 88111
  • 9413
  • 20
Vector Backbone
  • 62463
  • 62462
  • 62462
  • 62461
  • 61225
Fusion tag
  • 291237
  • 187387
  • 62461
  • 61225
  • 61224
Resistance Gene
  • 563554
  • 199158
  • 23502
Selectable Marker
  • 335060
  • 14372
  • 62
  • 5
  • 1
Promoter
  • 264113
  • 247372
  • 182020
  • 9106
  • 803
Expression Type
  • 442174
  • 247197
  • 6366
  • 4458
Application
  • 462719
  • 442121
  • 20
Format
  • 494623
  • 200014
  • 91174
  • 8
Supplier: Log in to see

Untagged full-length cDNA clone from Human LEO1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Leo1, Paf1/RNA Polymerase II Complex Component, Homolog (S. Cerevisiae) (LEO1)
NCBI Accession:
NM_138792,NP_620147
Species:
Human
Synonyms:
LEO1, leo1, LOC100466503, leo1.S, Leo1, LOC415420, LOC478310
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Rozenblatt-Rosen, Hughes, Nannepaga, Shanmugam, Copeland, Guszczynski, Resau, Meyerson: "The parafibromin tumor suppressor protein is part of a human Paf1 complex." in: Molecular and cellular biology, Vol. 25, Issue 2, pp. 612-20, 2005 (Pubmed)
Catalog No. ABIN3378663
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NEDD9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Neural Precursor Cell Expressed, Developmentally Down-Regulated 9 (NEDD9)
NCBI Accession:
NM_006403,NP_006394
Species:
Human
Synonyms:
NEDD9, Nedd9
Insert length:
4310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Sima, Cheng, Ye, Ma, Xie, Lü: "The overexpression of scaffolding protein NEDD9 promotes migration and invasion in cervical cancer via tyrosine phosphorylated FAK and SRC." in: PLoS ONE, Vol. 8, Issue 9, pp. e74594, 2013 (Pubmed)
Catalog No. ABIN3379093
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human P2RX5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Purinergic Receptor P2X, Ligand-Gated Ion Channel, 5 (P2RX5)
NCBI Accession:
NM_002561,NP_002552
Species:
Human
Synonyms:
P2RX5, P2rx5
Insert length:
2250 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kotnis, Bingham, Vasilyev, Miller, Bai, Yeola, Chanda, Bowlby, Kaftan, Samad, Whiteside: "Genetic and functional analysis of human P2X5 reveals a distinct pattern of exon 10 polymorphism with predominant expression of the nonfunctional receptor isoform." in: Molecular pharmacology, Vol. 77, Issue 6, pp. 953-60, 2010 (Pubmed)
Catalog No. ABIN3379248
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
NM_004620,NP_004611
Species:
Human
Synonyms:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4470 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Park, Huang, Lu, Cairo, Zhou: "MicroRNA-146a and microRNA-146b regulate human dendritic cell apoptosis and cytokine production by targeting TRAF6 and IRAK1 proteins." in: The Journal of biological chemistry, Vol. 290, Issue 5, pp. 2831-41, 2015 (Pubmed)
Catalog No. ABIN3380442
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human VTI1B is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Vesicle Transport through Interaction with T-SNAREs Homolog 1B (Yeast) (VTI1B)
NCBI Accession:
NM_006370,NP_006361
Species:
Human
Synonyms:
VTI1B, Vti1b, vti1b, LOC461624
Insert length:
5550 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cheng, Cebotaru, Cebotaru, Guggino: "Syntaxin 6 and CAL mediate the degradation of the cystic fibrosis transmembrane conductance regulator." in: Molecular biology of the cell, Vol. 21, Issue 7, pp. 1178-87, 2010 (Pubmed)
Catalog No. ABIN3380631
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human P4HB is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Prolyl 4-Hydroxylase, beta Polypeptide (P4HB)
NCBI Accession:
NM_000918,NP_000909
Species:
Human
Synonyms:
P4HB, P4hb, p4hb.L, LOC8281065
Insert length:
2700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Vatolin, Phillips, Jha, Govindgari, Hu, Grabowski, Parker, Lindner, Zhong, Distelhorst, Smith, Cotta, Xu, Chilakala, Kuang, Tall, Reu: "Novel Protein Disulfide Isomerase Inhibitor with Anticancer Activity in Multiple Myeloma." in: Cancer research, Vol. 76, Issue 11, pp. 3340-50, 2016 (Pubmed)
  • Zhao, Lu, Li: "Proapoptotic activities of protein disulfide isomerase (PDI) and PDIA3 protein, a role of the Bcl-2 protein Bak." in: The Journal of biological chemistry, Vol. 290, Issue 14, pp. 8949-63, 2015 (Pubmed)
  • Lee, Sun, Ho, Kiang, Zhang, Xu, Leung: "Hyperoxia resensitizes chemoresistant glioblastoma cells to temozolomide through unfolded protein response." in: Anticancer research, Vol. 34, Issue 6, pp. 2957-66, 2014 (Pubmed)
  • Pybus, Dean, West, Smith, Daramola, Field, Wilkinson, James: "Model-directed engineering of "difficult-to-express" monoclonal antibody production by Chinese hamster ovary cells." in: Biotechnology and bioengineering, Vol. 111, Issue 2, pp. 372-85, 2014 (Pubmed)
Catalog No. ABIN3379256
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PURA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Purine-Rich Element Binding Protein A (PURA)
NCBI Accession:
NM_005859,NP_005850
Species:
Human
Synonyms:
pura, Pura, PURA, puraa, pura.L
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3379641
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human CYP1A1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Cytochrome P450, Family 1, Subfamily A, Polypeptide 1 (CYP1A1)
NCBI Accession:
NM_000499,NP_000490
Species:
Human
Synonyms:
CYP1A1, CYP1D1, CpipJ_CPIJ010542, cyp1d1, Cyp1a1, LOC100328613
Insert length:
2310 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kekatpure, Dannenberg, Subbaramaiah: "HDAC6 modulates Hsp90 chaperone activity and regulates activation of aryl hydrocarbon receptor signaling." in: The Journal of biological chemistry, Vol. 284, Issue 12, pp. 7436-45, 2009 (Pubmed)
Catalog No. ABIN3377645
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human WNT4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 4 (WNT4)
NCBI Accession:
NM_030761,NP_110388
Species:
Human
Synonyms:
WNT4, Wnt4, wnt4.S, wnt4a
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Ring, Neth, Weber, Steffens, Faussner et al.: "β-Catenin-dependent pathway activation by both promiscuous "canonical" WNT3a-, and specific "noncanonical" WNT4- and WNT5a-FZD receptor combinations with strong differences in LRP5 and LRP6 ..." in: Cellular signalling, Vol. 26, Issue 2, pp. 260-7, 2013 (Pubmed)
Catalog No. ABIN3380666
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
NM_145803,NP_665802
Species:
Human
Synonyms:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhou, Wang, Schwartz, Stoffels, Park, Zhang, Yang, Demirkaya, Takeuchi, Tsai, Lyons, Yu, Ouyang, Chen, Chin, Zaal, Chandrasekharappa, P Hanson, Yu, Mullikin, Hasni, Wertz, Ombrello, Stone, Hoffmann et al.: "Loss-of-function mutations in TNFAIP3 leading to A20 haploinsufficiency cause an early-onset autoinflammatory disease. ..." in: Nature genetics, Vol. 48, Issue 1, pp. 67-73, 2015 (Pubmed)
  • Palamarchuk, Efanov, Nazaryan, Santanam, Alder, Rassenti, Kipps, Croce, Pekarsky: "13q14 deletions in CLL involve cooperating tumor suppressors." in: Blood, Vol. 115, Issue 19, pp. 3916-22, 2010 (Pubmed)
Catalog No. ABIN3380443
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human NDP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Norrie Disease (Pseudoglioma) (NDP)
NCBI Accession:
NM_000266,NP_000257
Species:
Human
Synonyms:
NDP, ndp.L, Ndp
Insert length:
1940 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • McNeill, Mazerolle, Bassett, Mears, Ringuette, Lagali, Picketts, Paes, Rice, Wallace: "Hedgehog regulates Norrie disease protein to drive neural progenitor self-renewal." in: Human molecular genetics, Vol. 22, Issue 5, pp. 1005-16, 2013 (Pubmed)
Catalog No. ABIN3382089
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PARG is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
PARG (PARG)
NCBI Accession:
NM_003631,NP_003622
Species:
Human
Synonyms:
PARG, Parg
Insert length:
4420 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Majewski, Thurston, Ramalingam, Kiela, Ghishan: "Cooperative role of NF-{kappa}B and poly(ADP-ribose) polymerase 1 (PARP-1) in the TNF-induced inhibition of PHEX expression in osteoblasts." in: The Journal of biological chemistry, Vol. 285, Issue 45, pp. 34828-38, 2010 (Pubmed)
Catalog No. ABIN3382100
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TSPAN6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Tetraspanin 6 (TSPAN6)
NCBI Accession:
NM_003270,NP_003261
Species:
Human
Synonyms:
TSPAN6, Tspan6, tspan6
Insert length:
1220 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Bonaparte, Dimitrov, Bossart, Crameri, Mungall, Bishop, Choudhry, Dimitrov, Wang, Eaton, Broder: "Ephrin-B2 ligand is a functional receptor for Hendra virus and Nipah virus." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 102, Issue 30, pp. 10652-7, 2005 (Pubmed)
Catalog No. ABIN3382165
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATF4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Activating Transcription Factor 4 (Tax-Responsive Enhancer Element B67) (ATF4)
NCBI Accession:
NM_001675,NP_001666
Species:
Human
Synonyms:
ATF4, atf4.L, atf4a, atf4, LOC468334, atf4b, Atf4
Insert length:
1200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhang, Lee, Min, McEntee, Jeong, Li, Baek: "The involvement of endoplasmic reticulum stress in the suppression of colorectal tumorigenesis by tolfenamic acid." in: Cancer prevention research (Philadelphia, Pa.), Vol. 6, Issue 12, pp. 1337-47, 2013 (Pubmed)
  • Armstrong, Flockhart, Veal, Lovat, Redfern: "Regulation of endoplasmic reticulum stress-induced cell death by ATF4 in neuroectodermal tumor cells." in: The Journal of biological chemistry, Vol. 285, Issue 9, pp. 6091-100, 2010 (Pubmed)
Catalog No. ABIN3382640
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
BCL2L1, Bcl2l1, bcl2l1, bcl2l1.L
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATP6V1A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATPase, H+ Transporting, Lysosomal 70kDa, V1 Subunit A (ATP6V1A)
NCBI Accession:
NM_001690,NP_001681
Species:
Human
Synonyms:
ATP6V1A, atp6v1aa, ANI_1_1468024, AOR_1_602134, atp6v1a.L, Atp6v0a1, Atp6v1a, Vha68-1, vpp3
Insert length:
2880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Adamson, Chohan, Swenson, LaJeunesse: "A Drosophila model for genetic analysis of influenza viral/host interactions." in: Genetics, Vol. 189, Issue 2, pp. 495-506, 2011 (Pubmed)
Catalog No. ABIN3382667
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LYPLA2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Lysophospholipase II (LYPLA2)
NCBI Accession:
NM_007260,NP_009191
Species:
Human
Synonyms:
LYPLA2, Lypla2, lypla2.S, lypla2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Navia-Paldanius, Patel, López Navarro, Jakupović, Goffart, Pasonen-Seppänen, Nevalainen, Jääskeläinen, Laitinen, Laitinen, Savinainen: "Chemoproteomic, biochemical and pharmacological approaches in the discovery of inhibitors targeting human α/β-hydrolase domain containing 11 (ABHD11)." in: European journal of pharmaceutical sciences : official journal of the European Federation for Pharmaceutical Sciences, Vol. 93, Issue , pp. 253-63, 2016 (Pubmed)
  • Manna, Wepy, Hsu, Chang, Cravatt, Marnett: "Identification of the major prostaglandin glycerol ester hydrolase in human cancer cells." in: The Journal of biological chemistry, Vol. 289, Issue 49, pp. 33741-53, 2014 (Pubmed)
Catalog No. ABIN3382070
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ADRB2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Adrenergic, beta-2-, Receptor, Surface (ADRB2)
NCBI Accession:
NM_000024,NP_000015
Species:
Human
Synonyms:
ADRB2, adrb2b, LOC100136153, Adrb2
Insert length:
2050 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Shinoda, Shinya, Ito, Ishizuka-Katsura, Ohsawa, Terada, Hirata, Kawano, Yamamoto, Tomita, Ishibashi, Hirabayashi, Kimura-Someya, Shirouzu, Yokoyama: "Cell-free methods to produce structurally intact mammalian membrane proteins." in: Scientific reports, Vol. 6, Issue , pp. 30442, 2016 (Pubmed)
  • Ferrie, Sun, Zaytseva, Fang: "Divergent label-free cell phenotypic pharmacology of ligands at the overexpressed β₂-adrenergic receptors." in: Scientific reports, Vol. 4, Issue , pp. 3828, 2014 (Pubmed)
  • Moriyama, Sitkovsky: "Adenosine A2A receptor is involved in cell surface expression of A2B receptor." in: The Journal of biological chemistry, Vol. 285, Issue 50, pp. 39271-88, 2010 (Pubmed)
  • Shi, Wu, Cui, Shi, Yang, Zhang, Rojas, Ha, Jiang: "PKA phosphorylation of SUR2B subunit underscores vascular KATP channel activation by beta-adrenergic receptors." in: American journal of physiology. Regulatory, integrative and comparative physiology, Vol. 293, Issue 3, pp. R1205-14, 2007 (Pubmed)
Catalog No. ABIN3382386
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ADRM1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Adhesion Regulating Molecule 1 (Adrm1)
NCBI Accession:
NM_007002,NP_008933
Species:
Human
Synonyms:
adrm1, ADRM1, CpipJ_CPIJ002929, SJAG_04211, Adrm1
Insert length:
1390 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Mazumdar, Gorgun, Sha, Tyryshkin, Zeng, Hartmann-Petersen, Jørgensen, Hendil, Eissa: "Regulation of NF-kappaB activity and inducible nitric oxide synthase by regulatory particle non-ATPase subunit 13 (Rpn13)." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 107, Issue 31, pp. 13854-9, 2010 (Pubmed)
Catalog No. ABIN3382389
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ALDH2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Aldehyde Dehydrogenase 2 Family (Mitochondrial) (ALDH2)
NCBI Accession:
NM_000690,NP_000681
Species:
Human
Synonyms:
aldh2.1, aldh2.L, aldh2, ALDH2, RHA1_RS43090, aldH2, OE_RS03015, Aldh2
Insert length:
2100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Keller, Watschinger, Lange, Golderer, Werner-Felmayer, Hermetter, Wanders, Werner: "Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds." in: Journal of lipid research, Vol. 53, Issue 7, pp. 1410-6, 2012 (Pubmed)
Catalog No. ABIN3382447
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...