Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

65 Products
Type
  • 65
    Plasmid
Application
  • 37
  • 31
  • 27
  • 16
  • 8
Fusion tag
  • 31
  • 8
  • 4
  • 3
  • 3
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Vector
  • 35
  • 18
  • 5
  • 4
  • 3
Insert
  • 786657
  • 661370
  • 356738
  • 154622
  • 114972
Resistance Gene
  • 33
  • 30
  • 2
Expression Type
  • 64
  • 50
  • 1
Selectable Marker
  • 28
  • 10
  • 7
  • 4
  • 2
Promoter
  • 27
  • 13
  • 11
  • 8
  • 8
Format
  • 54
  • 9

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot1
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680322
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot2
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680323
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot4
Resistance Gene:
Ampicillin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680325
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot5
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680326
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot6
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680327
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot7
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680328
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot8
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680329
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-Blank
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Expression:
Transient,Stable

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372074
$110.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
Empty
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-Blank
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4372073
$110.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRFP-C-RS
Resistance Gene:
Chloramphenicol
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
RFP tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948188
$180.00
5 μg
Plus shipping costs $45.00
Will be delivered in 11 Business Days

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pRS
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948189
$180.00
5 μg
Plus shipping costs $45.00
Will be delivered in 11 Business Days

Type:
Empty
Application:
Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
pGFP-V-RS
Resistance Gene:
Kanamycin
Selection Marker:
Puromycin
Promoter:
U6 Promoter
Fusion Tag:
GFP tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN4948187
$200.00
5 μg
Plus shipping costs $45.00
Will be delivered in 11 Business Days

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948152
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948154
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948153
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948155
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948158
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948156
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948157
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
Empty
Application:
Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
CMV Promoter
Expression:
Transient, Stable

Sequencing Primer:
  • Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
Components:
Each tube contains approximately 10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN4948159
$202.73
10 μg
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1