Empty Backbones
Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.
Blank-Control Bacterial expression Vector
- Type:
- Empty
- Vector type:
- Bacterial Expression Vector
- Vector backbone:
- pPB-Blank
- Resistance Gene:
- Kanamycin
- Promoter:
- T7 Promoter
- Expression:
- Transient
- Sequencing Primer:
- T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
- T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
- Buffer:
- 10 mM Tris-HCI, 1 mM EDTA, pH 8.0
- Storage:
- -20 °C
Delivery in 11 to 21 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
Blank-Control Mammalian expression Vector
- Type:
- Empty
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pPM-Blank
- Resistance Gene:
- Kanamycin
- Selection Marker:
- Neomycin
- Promoter:
- CMV Promoter
- Expression:
- Transient,Stable
- Sequencing Primer:
- CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
- Buffer:
- 10 mM Tris-HCI, 1 mM EDTA, pH 8.0
- Storage:
- -20 °C
Delivery in 11 to 21 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot1 is an high expression vector for N-terminal Spot-Tag® fusion proteins in E. coli.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Bacterial Expression Vector
- Vector backbone:
- pSpot1
- Resistance Gene:
- Kanamycin
- Promoter:
- T7 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot2 is an high expression vector for C-terminal Spot-Tag® fusion proteins in E. coli.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Bacterial Expression Vector
- Vector backbone:
- pSpot2
- Resistance Gene:
- Kanamycin
- Promoter:
- T7 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot4 is an low expression vector for N-terminal Spot-Tag® fusion proteins in E. coli.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Bacterial Expression Vector
- Vector backbone:
- pSpot4
- Resistance Gene:
- Ampicillin
- Promoter:
- T7 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot7 is an high expression vector for N-terminal Spot-Tag® fusion proteins in S. cerevisiae.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Yeast Expression Vector
- Vector backbone:
- pSpot7
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Leucin
- Promoter:
- TPI1 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot8 is an high expression vector for C-terminal Spot-Tag® fusion proteins in S. cerevisiae.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Yeast Expression Vector
- Vector backbone:
- pSpot8
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Leucin
- Promoter:
- TPI1 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot5 is an low expression vector for N-terminal Spot-Tag® fusion proteins in S. cerevisiae.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Yeast Expression Vector
- Vector backbone:
- pSpot5
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Leucin
- Promoter:
- TPI1 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
The plasmid pSpot6 is an low expression vector for C-terminal Spot-Tag® fusion proteins in S. cerevisiae.
- Type:
- Empty
- Application:
- Cloning, Protein Extraction
- Vector type:
- Yeast Expression Vector
- Vector backbone:
- pSpot6
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Leucin
- Promoter:
- TPI1 Promoter
- Fusion Tag:
- Spot-Tag
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 5 to 6 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Negative Contol Vector (untagged)
- Type:
- Empty
- Application:
- Negative Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Negative Control Vector (His-tagged)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-His
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Negative Control Vector (FLAG-tagged)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-FLAG
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Negative Control Vector (Myc-tagged)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-Myc
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-His
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-FLAG
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-Myc
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)
- Type:
- Empty
- Application:
- Positive Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-HA
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
pCMV / hygro-Negative Control Vector (HA-tagged)
- Type:
- Empty
- Application:
- Negative Control, Control
- Vector type:
- Mammalian Expression Vector
- Vector backbone:
- pCMV-hygro-HA
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Hygromycin
- Promoter:
- CMV Promoter
- Fusion Tag:
- HA tag
- Expression:
- Transient, Stable
- Sequencing Primer:
- Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
- Forward:T7(TAATACGACTCACTATAGGG)
- Components:
- Each tube contains approximately 10 μg of lyophilized plasmid
- Format:
- Lyophilized
- Storage:
- -20 °C
Delivery in 11 to 13 Business Days
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
shRNA RFP Cloning Vector (pRFP-C-RS Vector)
- Type:
- Empty
- Application:
- Negative Control, Cloning
- Vector type:
- Retroviral Vector
- Vector backbone:
- pRFP-C-RS
- Resistance Gene:
- Chloramphenicol
- Selection Marker:
- Puromycin
- Promoter:
- U6 Promoter
- Fusion Tag:
- RFP tag
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- 4 °C/-20 °C
Available
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
shRNA pRS Cloning Vector
- Type:
- Empty
- Application:
- Negative Control, Cloning
- Vector type:
- Retroviral Vector
- Vector backbone:
- pRS
- Resistance Gene:
- Ampicillin
- Selection Marker:
- Puromycin
- Promoter:
- U6 Promoter
- Expression:
- Transient, Stable
- Format:
- Lyophilized
- Storage:
- 4 °C/-20 °C
Available
- Order hotline:
- +1 877 302 8632
- +1 888 205 9894 (Toll-free)
- antibodies-online
- antikoerper-online.de (deutsch)
- antibodies-online.com (english)
- anticorps-enligne.fr (français)
- antibodies-online.cn (中文)
- genomics-online
- genomics-online.com (english)