Empty Backbones

Empty backbones are used in molecular biology to multiply, isolate or express the insert in a target cell. So you are able to test the functionality of the gene of interest under various conditions and in a controlled environment. On genomics-online.com you will find a range of hand-selected empty backbones, as well as a wide variety of plasmid-based products. If you need help with finding the right vector, please contact our customer support.

48 Products
  • 48
  • 785880
  • 437352
  • 365415
  • 154625
  • 114972
  • 35
  • 9
  • 3
  • 1
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 23
  • 4
  • 3
  • 3
  • 3
Resistance Gene
  • 26
  • 20
  • 2
Selectable Marker
  • 26
  • 6
  • 5
  • 1
  • 27
  • 8
  • 5
  • 4
  • 1
Expression Type
  • 47
  • 38
  • 1
  • 31
  • 26
  • 20
  • 8
  • 7
  • 38
  • 8
Supplier: Log in to see

shRNA GFP Lenti Cloning Vector (pGFP-C-shLenti Vector)

Negative Control, Cloning
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
GFP tag
Transient, Stable

4 °C/-20 °C
Catalog No. ABIN4948186
5 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

Cloning vector pCMV6-XL5 as negative control

Negative Control, Cloning
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
    XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
4 °C/-20 °C
Catalog No. ABIN4948184
10 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (HA-tagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948153
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (His-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948154
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (Myc-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948155
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948157
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948159
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Contol Vector (untagged)

Negative Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948152
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Negative Control Vector (FLAG-tagged)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948156
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-His tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948158
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

pCMV / hygro-Positive Control Vector (C-terminal Fc-FLAG tag)

Positive Control, Control
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Transient, Stable

Sequencing Primer:
Each tube contains approximately 10 μg of lyophilized plasmid
-20 °C
Catalog No. ABIN4948160
10 μg
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-tRFP)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Fusion Tag:
RFP tag

Glycerol Stock
-80 °C
Catalog No. ABIN5074758
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-ZsGreen)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Fusion Tag:

Glycerol Stock
-80 °C
Catalog No. ABIN5074757
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-ZsGreen)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Fusion Tag:
Stable, Transient

Glycerol Stock
-80 °C
Catalog No. ABIN5074769
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-tRFP)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Fusion Tag:
RFP tag

Glycerol Stock
-80 °C
Catalog No. ABIN5074770
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-Blast)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Stable, Transient

Glycerol Stock
-80 °C
Catalog No. ABIN5074756
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-EFS-Puro)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Stable, Transient

Glycerol Stock
-80 °C
Catalog No. ABIN5074755
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-Puro)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Stable, Transient

Glycerol Stock
-80 °C
Catalog No. ABIN5074767
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

transEDIT gRNA plus Cas9 Cloning Vector (pCLIP-All-hCMV-Blast)

Cloning, Genome Editing with Engineered Nucleases
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Stable, Transient

Glycerol Stock
-80 °C
Catalog No. ABIN5074768
1 vial
Plus shipping costs $45.00
Will be delivered in 2 to 3 Business Days
Supplier: Log in to see

shRNA RFP Cloning Vector (pRFP-C-RS Vector)

Negative Control, Cloning
Vector type:
Retroviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter
Fusion Tag:
RFP tag
Transient, Stable

4 °C/-20 °C
Catalog No. ABIN4948188
5 μg
Plus shipping costs $45.00
Will be delivered in 10 to 12 Business Days
  • <
  • 1