Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,066,194 Products
Data Quality
  • 2017
Type
  • 1066194
    Plasmid
Gene
  • 944
  • 305
  • 302
  • 257
  • 243
Species
  • 422383
  • 349502
  • 204094
  • 19977
  • 18115
Application
  • 738739
  • 364999
  • 41222
  • 39141
  • 27
Fusion tag
  • 207875
  • 216503
  • 93546
  • 91554
  • 75056
Vector Backbone
  • 108654
  • 62478
  • 62478
  • 62477
  • 62475
Vector
  • 817584
    Mammalian Expression Vector
  • 683539
  • 248610
    Bacterial Expression Vector
  • 161837
  • 145355
Insert
  • 688819
  • 296972
  • 41222
  • 39141
  • 40
Resistance Gene
  • 809386
  • 256808
Expression Type
  • 887855
  • 357188
  • 178317
  • 6366
Selectable Marker
  • 411203
  • 178551
  • 57
Promoter
  • 407093
  • 398804
  • 264668
  • 80364
  • 3184
Format
  • 496010
  • 452247
  • 117935

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot1
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680322
$68.75
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot2
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680323
$68.75
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot4
Resistance Gene:
Ampicillin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680325
$68.75
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cofilin 1 (Non-Muscle) (CFL1)
NCBI Accession:
NM_005507,NP_005498
Species:
Human
Synonyms:
cfl1.L, cfl1, cfl1l, CFL1, tsr, COF1, TSTA_042790, Cfl1, CFL
Insert length:
501 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396423
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 5 (CMTM5)
NCBI Accession:
NM_138460,NP_612469
Species:
Human
Synonyms:
CMTM5, Cmtm5
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396783
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8)
NCBI Accession:
NM_178868,NP_849199
Species:
Human
Synonyms:
cmtm8.L, CMTM8, cmtm8, Cmtm8
Insert length:
522 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396796
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CKS2
NCBI Accession:
NM_001827,NP_001818
Species:
Human
Synonyms:
CKS2, Cks2, cks2
Insert length:
240 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396668
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
C-Type Lectin Domain Family 2, Member D (CLEC2D)
NCBI Accession:
NM_013269,NP_037401
Species:
Human
Synonyms:
CLEC2D, Clec2d
Insert length:
576 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396719
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
C-Type Lectin Domain Family 4, Member A (CLEC4A)
NCBI Accession:
NM_194448,NP_919430
Species:
Human
Synonyms:
ZNF705A, CLEC4A, Clec4a, Clec4a2
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396743
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chloride Channel, Nucleotide-Sensitive, 1A (CLNS1A)
NCBI Accession:
NM_001293,NP_001284
Species:
Human
Synonyms:
CLNS1A, Clns1a, clns1a.L, clns1a
Insert length:
714 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396768
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Calcitonin-Related Polypeptide beta (CALCB)
NCBI Accession:
NM_000728,NP_000719
Species:
Human
Synonyms:
CALCB, LOC698209, Calcb
Insert length:
384 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5397952
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Carnitine O-Octanoyltransferase (CROT)
NCBI Accession:
NM_001143935,NP_001137407
Species:
Human
Synonyms:
CROT, crot, Crot
Insert length:
1923 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5398024
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cerebellin 1 Precursor (CBLN1)
NCBI Accession:
NM_004352,NP_004343
Species:
Human
Synonyms:
cbln3, cbln1, cbln1.L, CBLN1, Cbln1
Insert length:
582 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5398152
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Destrin (Actin Depolymerizing Factor) (DSTN)
NCBI Accession:
NM_006870,NP_006861
Species:
Human
Synonyms:
DSTN, dstn, Dstn, dstn.S
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5400522
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 2 (NUDT2)
NCBI Accession:
NM_147172,NP_671701
Species:
Human
Synonyms:
apaH, Tb927.8.8040, EAMY_RS30850, NUDT2, nudt2, nudt2.S, Nudt2
Insert length:
444 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5400551
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 2 (NUDT2)
NCBI Accession:
NM_001161,NP_001152
Species:
Human
Synonyms:
apaH, Tb927.8.8040, EAMY_RS30850, NUDT2, nudt2, nudt2.S, Nudt2
Insert length:
444 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5400552
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Spermidine/spermine N1-Acetyltransferase 1 (SAT1)
NCBI Accession:
NM_002970,NP_002961
Species:
Human
Synonyms:
SAT1, sat1.L, sat1, Sat1, sat1b
Insert length:
516 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5400565
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
CDC14 Cell Division Cycle 14 Homolog A (S. Cerevisiae) (CDC14A)
NCBI Accession:
NM_033312,NP_201569
Species:
Human
Synonyms:
CDC14A, TVAG_168700, TVAG_479730, TVAG_362610, TVAG_490830, GL50803_9270, CMU_014610, cdc14a.L, Cdc14a, cdc14a, cdc14aa
Insert length:
1872 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396106
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
ST6 beta-Galactosamide alpha-2,6-Sialyltranferase 1 (ST6GAL1)
NCBI Accession:
NM_173217,NP_775324
Species:
Human
Synonyms:
ST6GAL1, St6gal1, st6gal1
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396035
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cell Division Cycle 25 Homolog A (S. Pombe) (CDC25A)
NCBI Accession:
NM_001789,NP_001780
Species:
Human
Synonyms:
CDC25A, cdc25a, cdc25b, Cdc25a, cdc25a.S
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5396170
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...