Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,066,193 Products
Data Quality
  • 2020
  • 1066193
  • 944
  • 305
  • 302
  • 257
  • 243
  • 422382
  • 349502
  • 204094
  • 19977
  • 18115
  • 738738
  • 364999
  • 41222
  • 39141
  • 27
Fusion tag
  • 207875
  • 216503
  • 93546
  • 91554
  • 75056
Vector Backbone
  • 108654
  • 62478
  • 62478
  • 62477
  • 62475
  • 817583
    Mammalian Expression Vector
  • 683539
  • 248610
    Bacterial Expression Vector
  • 161837
  • 145351
  • 688819
  • 296971
  • 41222
  • 39141
  • 40
Resistance Gene
  • 809385
  • 256808
Expression Type
  • 887855
  • 357188
  • 178316
  • 6366
Selectable Marker
  • 411203
  • 178550
  • 57
  • 407093
  • 398803
  • 264668
  • 80364
  • 3184
  • 496010
  • 452246
  • 117935

Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

-20 °C
Catalog No. ABIN5680322
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

-20 °C
Catalog No. ABIN5680323
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

-20 °C
Catalog No. ABIN5680325
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Protein Expression
Cofilin 1 (Non-Muscle) (CFL1)
NCBI Accession:
cfl1.L, cfl1, cfl1l, CFL1, tsr, COF1, TSTA_042790, Cfl1, CFL
Insert length:
501 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396423
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 5 (CMTM5)
NCBI Accession:
CMTM5, Cmtm5
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396783
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
CKLF-Like MARVEL Transmembrane Domain Containing 8 (CMTM8)
NCBI Accession:
cmtm8.L, CMTM8, cmtm8, Cmtm8
Insert length:
522 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396796
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
NCBI Accession:
CKS2, Cks2, cks2
Insert length:
240 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396668
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
C-Type Lectin Domain Family 2, Member D (CLEC2D)
NCBI Accession:
CLEC2D, Clec2d
Insert length:
576 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396719
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
C-Type Lectin Domain Family 4, Member A (CLEC4A)
NCBI Accession:
ZNF705A, CLEC4A, Clec4a, Clec4a2
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396743
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Chloride Channel, Nucleotide-Sensitive, 1A (CLNS1A)
NCBI Accession:
CLNS1A, Clns1a, clns1a.L, clns1a
Insert length:
714 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396768
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Calcitonin-Related Polypeptide beta (CALCB)
NCBI Accession:
CALCB, LOC698209, Calcb
Insert length:
384 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5397952
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Carnitine O-Octanoyltransferase (CROT)
NCBI Accession:
CROT, crot, Crot
Insert length:
1923 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5398024
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Cerebellin 1 Precursor (CBLN1)
NCBI Accession:
cbln3, cbln1, cbln1.L, CBLN1, Cbln1
Insert length:
582 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5398152
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Destrin (Actin Depolymerizing Factor) (DSTN)
NCBI Accession:
DSTN, dstn, Dstn, dstn.S
Insert length:
498 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5400522
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 2 (NUDT2)
NCBI Accession:
apaH, Tb927.8.8040, EAMY_RS30850, NUDT2, nudt2, nudt2.S, Nudt2
Insert length:
444 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5400551
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 2 (NUDT2)
NCBI Accession:
apaH, Tb927.8.8040, EAMY_RS30850, NUDT2, nudt2, nudt2.S, Nudt2
Insert length:
444 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5400552
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Spermidine/spermine N1-Acetyltransferase 1 (SAT1)
NCBI Accession:
SAT1, sat1.L, sat1, Sat1, sat1b
Insert length:
516 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5400565
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
CDC14 Cell Division Cycle 14 Homolog A (S. Cerevisiae) (CDC14A)
NCBI Accession:
CDC14A, TVAG_168700, TVAG_479730, TVAG_362610, TVAG_490830, GL50803_9270, CMU_014610, cdc14a.L, Cdc14a, cdc14a, cdc14aa
Insert length:
1872 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396106
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
ST6 beta-Galactosamide alpha-2,6-Sialyltranferase 1 (ST6GAL1)
NCBI Accession:
ST6GAL1, St6gal1, st6gal1
Insert length:
528 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396035
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression
Cell Division Cycle 25 Homolog A (S. Pombe) (CDC25A)
NCBI Accession:
CDC25A, cdc25a, cdc25b, Cdc25a, cdc25a.S
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5396170
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...