Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,068,833 Products
Data Quality
  • 2025
  • 2296
Type
  • 1068833
    Plasmid
Gene
  • 1005
  • 300
  • 293
  • 258
  • 245
Species
  • 424453
  • 349817
  • 204215
  • 19989
  • 18117
Insert
  • 690102
  • 298329
  • 41222
  • 39141
  • 39
Vector
  • 820024
    Mammalian Expression Vector
  • 515568
  • 248809
    Bacterial Expression Vector
  • 161840
  • 145458
Vector Backbone
  • 108704
  • 62527
  • 62526
  • 62525
  • 62525
Fusion tag
  • 209109
  • 216771
  • 93571
  • 91689
  • 75062
Resistance Gene
  • 810662
  • 258171
Selectable Marker
  • 411484
  • 179828
  • 57
Promoter
  • 407320
  • 401017
  • 265669
  • 80364
  • 3184
Expression Type
  • 889218
  • 357445
  • 179593
  • 6366
Application
  • 741180
  • 365200
  • 41222
  • 39141
  • 26
Format
  • 496405
  • 454488
  • 117938
Supplier: Log in to see

Full length Clone DNA of Homo sapiens agouti related protein homolog (mouse) (AGRP), transcript variant 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Agouti Related Protein Homolog (Mouse) (AGRP)
NCBI Accession:
NM_001138
Species:
Human
Synonyms:
AGRP, Agrp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615000
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens SH2 domain protein 1A with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
SH2 Domain Containing 1A (SH2D1A)
NCBI Accession:
NM_002351
Species:
Human
Synonyms:
SH2D1A, Sh2d1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3584949
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow).

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
tnnc1.L, tnnc1, TNNC1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605040
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
tnnc1.L, tnnc1, TNNC1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605041
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4.

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet-Derived Family, Member 4 (REG4)
NCBI Accession:
NM_032044
Species:
Human
Synonyms:
Reg4, REG4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644688
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IB (pancreas) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Phospholipase A2 (YWHAZ)
NCBI Accession:
NM_000928
Species:
Human
Synonyms:
CG42237, PLA2, LOC100631065, Pla2, PLA2G1B, Pla2g1b, PLA2G4A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631492
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IIA (platelets, synovial fluid) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
phospholipase A2, Group IIA (Platelets, Synovial Fluid) (PLA2G2A)
NCBI Accession:
NM_000300
Species:
Human
Synonyms:
PLA2G2A, Pla2g2a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631517
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens prokineticin 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Prokineticin 1 (Prok1)
NCBI Accession:
NM_032414
Species:
Human
Synonyms:
PROK1, prok1, Prok1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3637206
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cyclin-Dependent Kinase Inhibitor 2B (p15, Inhibits CDK4) (CDKN2B)
NCBI Accession:
NM_004936
Species:
Human
Synonyms:
CDKN2B, cdn2b, cdkn2b, cdkn2b.L, Cdkn2b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3973359
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10 (CXCL10)
NCBI Accession:
NM_001565
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981002
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10 (CXCL10)
NCBI Accession:
NM_001565
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981003
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 13 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 13 (CXCL13)
NCBI Accession:
NM_006419
Species:
Human
Synonyms:
Cxcl13, CXCL13
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981082
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 17 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 17 (CXCL17)
NCBI Accession:
NM_198477
Species:
Human
Synonyms:
CXCL17, Cxcl17
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981174
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 17.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 17 (CXCL17)
NCBI Accession:
NM_198477
Species:
Human
Synonyms:
CXCL17, Cxcl17
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981173
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 5 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 5 (CXCL5)
NCBI Accession:
NM_002994
Species:
Human
Synonyms:
CXCL5, Cxcl6, LOC701946, LOC703222, Cxcl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981264
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 5 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 5 (CXCL5)
NCBI Accession:
NM_009141
Species:
Mouse (Murine)
Synonyms:
CXCL5, Cxcl6, LOC701946, LOC703222, Cxcl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981276
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 11 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 11 (CXCL11)
NCBI Accession:
NM_005409
Species:
Human
Synonyms:
CXCL11, Cxcl11
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981037
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cystatin B (stefin B) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cystatin B (Stefin B) (CSTB)
NCBI Accession:
NM_000100
Species:
Human
Synonyms:
CSTB, Cstb, cstb, cst14a.2, CYSB, cpi1, LOC101123265
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3979984
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cystatin S.

Type:
ORF
Application:
Protein Expression
Gene:
Cystatin S (CST4)
NCBI Accession:
NM_001899
Species:
Human
Synonyms:
CST4, Cyss
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3979882
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens SUZ RNA binding domain containing 1.

Type:
ORF
Application:
Protein Expression
Gene:
Chromosome 1 Open Reading Frame 144 (C1orf144)
NCBI Accession:
NR_073502
Species:
Human
Synonyms:
szrd1.L, szrd1, SZRD1, Szrd1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3596546
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...