Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,068,806 Products
Data Quality
  • 2025
  • 2296
Type
  • 1068806
    Plasmid
Gene
  • 997
  • 306
  • 302
  • 258
  • 245
Species
  • 424426
  • 349817
  • 204215
  • 19989
  • 18117
Insert
  • 690102
  • 298302
  • 41222
  • 39141
  • 39
Vector
  • 819997
    Mammalian Expression Vector
  • 683691
  • 248809
    Bacterial Expression Vector
  • 161840
  • 145458
Vector Backbone
  • 108681
  • 62527
  • 62526
  • 62525
  • 62525
Fusion tag
  • 209109
  • 216771
  • 93548
  • 91689
  • 75058
Resistance Gene
  • 810639
  • 258167
Selectable Marker
  • 411480
  • 179828
  • 57
Promoter
  • 407293
  • 401017
  • 265669
  • 80364
  • 3184
Expression Type
  • 889191
  • 357441
  • 179593
  • 6366
Application
  • 741153
  • 365200
  • 41222
  • 39141
  • 26
Format
  • 496405
  • 454461
  • 117938
Supplier: Log in to see

Full length Clone DNA of Homo sapiens agouti related protein homolog (mouse) (AGRP), transcript variant 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Agouti Related Protein Homolog (Mouse) (AGRP)
NCBI Accession:
NM_001138
Species:
Human
Synonyms:
AGRP, Agrp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615000
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4.

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet-Derived Family, Member 4 (REG4)
NCBI Accession:
NM_032044
Species:
Human
Synonyms:
Reg4, REG4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644688
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IB (pancreas) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Phospholipase A2 (YWHAZ)
NCBI Accession:
NM_000928
Species:
Human
Synonyms:
CG42237, PLA2, LOC100631065, Pla2, PLA2G1B, Pla2g1b, PLA2G4A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631492
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IIA (platelets, synovial fluid) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
phospholipase A2, Group IIA (Platelets, Synovial Fluid) (PLA2G2A)
NCBI Accession:
NM_000300
Species:
Human
Synonyms:
PLA2G2A, Pla2g2a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631517
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens prokineticin 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Prokineticin 1 (Prok1)
NCBI Accession:
NM_032414
Species:
Human
Synonyms:
PROK1, prok1, Prok1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3637206
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens histone cluster 2, H2be with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Histone H2B Type 2-E
NCBI Accession:
NM_003528
Species:
Human
Synonyms:
Hist2h2be, HIST2H2BE, Hist1h2bl, H2B
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3906285
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens platelet factor 4 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Platelet Factor 4 (PF4)
NCBI Accession:
NM_002619
Species:
Human
Synonyms:
PF4, Pf4, LOC703451, LOC100524373, LOC102181854, LOC100630489
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629102
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens S100 calcium binding protein A16 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein A16 (S100A16)
NCBI Accession:
NM_080388
Species:
Human
Synonyms:
S100A16, S100a16
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3579706
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens A kinase (PRKA) anchor protein 7 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
A Kinase (PRKA) Anchor Protein 7 (AKAP7)
Species:
Human
Synonyms:
AKAP7, akap7.L, akap7, Akap7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615864
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens galanin prepropeptide with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Galanin Prepropeptide (GAL)
NCBI Accession:
NM_015973
Species:
Human
Synonyms:
gal.2, Gal, GAL
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3900581
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet-Derived Family, Member 4 (REG4)
NCBI Accession:
NM_032044
Species:
Human
Synonyms:
Reg4, REG4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644689
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens thioredoxin domain containing 17 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Thioredoxin Domain Containing 17 (TXNDC17)
NCBI Accession:
NM_032731
Species:
Human
Synonyms:
TXNDC17, Txndc17, txndc17
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3568391
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cortistatin with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cortistatin (CORT)
NCBI Accession:
NM_001302
Species:
Human
Synonyms:
CORT, Cort
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3977961
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens S100 calcium binding protein B with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein B (S100B)
NCBI Accession:
NM_006272
Species:
Human
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3579980
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens platelet-activating factor with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
PCNA Clamp Associated Factor (PAF)
NCBI Accession:
NM_014736
Species:
Human
Synonyms:
PCLAF, pclaf, pclaf.S, Pclaf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3914216
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens neuropeptide Y with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Neuropeptide Y (NPY)
NCBI Accession:
NM_000905
Species:
Human
Synonyms:
Npy, NPY, npy, npy.S, npy.L, LOC100533423
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3621035
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens histone cluster 2, H4a with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Histone Cluster 2, H4a (HIST2H4A)
NCBI Accession:
NM_003548
Species:
Human
Synonyms:
HIST2H4A, Hist2h4, HIST2H4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3906314
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens midkine (neurite growth-promoting factor 2), transcript variant 2 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Midkine (Neurite Growth-Promoting Factor 2) (MDK)
NCBI Accession:
NM_001012333
Species:
Human
Synonyms:
MDK, Mdk, mdk.L, mdkb
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3920561
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow).

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
TNNC1, tnnc1a, tnnc1.L, tnnc1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605040
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
TNNC1, tnnc1a, tnnc1.L, tnnc1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605041
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...