Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

Data Quality
  • 2020
  • 2154
Type
  • 957340
    Plasmid
Gene
  • 944
  • 244
  • 178
  • 175
  • 172
Species
  • 396253
  • 307322
  • 189881
  • 19977
  • 9058
Application
  • 680285
  • 306838
  • 39141
  • 27
  • 26
Fusion tag
  • 158834
  • 209598
  • 93550
  • 89225
  • 59523
Vector Backbone
  • 108658
  • 60188
  • 60187
  • 60187
  • 60185
Vector
  • 239423
    Bacterial Expression Vector
  • 717917
    Mammalian Expression Vector
  • 683543
  • 161849
  • 105649
Insert
  • 621471
  • 296690
  • 39141
  • 38
Resistance Gene
  • 749602
  • 207738
Expression Type
  • 779292
  • 306779
  • 178026
  • 3183
Selectable Marker
  • 360793
  • 178261
  • 57
Promoter
  • 356701
  • 349529
  • 255481
  • 39142
  • 1592
Format
  • 477647
  • 410743
  • 68950
957,340 Products

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot1
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680322
$75.00
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot2
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680323
$75.00
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot4
Resistance Gene:
Ampicillin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680325
$75.00
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Histone Cluster 2, H4b (HIST2H4B)
NCBI Accession:
NM_001034077,NP_001029249
Species:
Human
Synonyms:
HIST2H4B
Insert length:
312 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5327083
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 50 (Sugar Transporter), Member 1 (RAG1AP1)
NCBI Accession:
NM_018845,NP_061333
Species:
Human
Synonyms:
SLC50A1, Slc50a1, slv, slc50a1.L, slc50a1
Insert length:
666 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5327138
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Defensin, beta 107B (DEFB107B)
NCBI Accession:
NM_001040705,NP_001035795
Species:
Human
Synonyms:
DEFB107B
Insert length:
213 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5328328
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Histone Cluster 1, H4d (HIST1H4D)
NCBI Accession:
NM_003539,NP_003530
Species:
Human
Synonyms:
Hist1h4d, HIST1H4D, hist1h4d.L
Insert length:
312 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5328126
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Zinc Finger Protein 593 (ZNF593)
NCBI Accession:
NM_015871,NP_056955
Species:
Human
Synonyms:
ZNF593, Zfp593
Insert length:
405 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5370678
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cystatin E/M (CST6)
NCBI Accession:
NM_001323,NP_001314
Species:
Human
Synonyms:
CST6, Cst6
Insert length:
450 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5372486
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
DCMP Deaminase (DCTD)
NCBI Accession:
NM_001921,NP_001912
Species:
Human
Synonyms:
DCTD, dctd, dctD, Dctd, AFUA_2G06240, ACLA_068070, LELG_03636, VIBHAR_RS20285, LOC5564022, Ccur_00700, PAAG_00286, SPAP_0719, LOC100285892, dctd.L, CNB00950, THAPS_42740, dCMP deaminase, Thena_0587, Ccan_15560
Insert length:
537 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5372494
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cytochrome C Oxidase Subunit IV Isoform 2 (Lung) (COX4I2)
NCBI Accession:
NM_032609,NP_115998
Species:
Human
Synonyms:
COX4I2, cox4i2, cox4i2.S, Cox4i2
Insert length:
516 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5372519
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cytochrome C Oxidase Subunit VIb Polypeptide 2 (Testis) (COX6B2)
NCBI Accession:
NM_144613,NP_653214
Species:
Human
Synonyms:
COX6B2, Cox6b2, cox6b2
Insert length:
267 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5372527
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Immature Colon Carcinoma Transcript 1 (ICT1)
NCBI Accession:
NM_001545,NP_001536
Species:
Human
Synonyms:
MRPL58, mrpl58.S, PVX_091510, mrpl58, Mrpl58, ict1
Insert length:
621 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5373159
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 19 (IL19)
NCBI Accession:
NM_013371,NP_037503
Species:
Human
Synonyms:
IL19, Il19
Insert length:
534 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5373293
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 27 (IL27)
NCBI Accession:
NM_145659,NP_663634
Species:
Human
Synonyms:
IL27, Il27
Insert length:
732 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5373307
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Transmembrane Protein 11 (TMEM11)
NCBI Accession:
NM_003876,NP_003867
Species:
Human
Synonyms:
TMEM11, Tmem11, tmem11.L
Insert length:
579 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379993
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
DPY30 Domain Containing 1 (DYDC1)
NCBI Accession:
NM_138812,NP_620167
Species:
Human
Synonyms:
DYDC1, dydc1.L, Dydc1
Insert length:
534 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5380049
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Ring Finger Protein 181
NCBI Accession:
NM_016494,NP_057578
Species:
Human
Synonyms:
RNF181, Rnf181, rnf181.S, rnf181
Insert length:
462 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5380068
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein A12 (S100A12)
NCBI Accession:
NM_005621,NP_005612
Species:
Human
Synonyms:
S100A12, LOC101103771
Insert length:
279 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379532
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Zinc Finger Protein 185 (ZNF185)
NCBI Accession:
NM_001178110,NP_001171581
Species:
Human
Synonyms:
ZNF185, LOC693882, Zfp185
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5379905
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...