Expression Vectors

Expression vectors, like cloning vectors, are used for horizontal gene transmission. Cloning vectors are primarily used for replication – generating a large number of copies of the same plasmid. Expression vectors will contain all of the same basic elements present in a cloning vector and additionally a promoter sequence that recruits transcriptional machinery, and directs the host organism to transcribe an RNA template from the cloned gene product.

Choose at genomics-online between a variety of promoter sequences based upon gene cloned into the expression vector, the organism and cell type the gene to be expressed in and desired expression level. Browse our high-quality products. For more detailed information visit our resource site with detailed information and differentiation between cloning and expression vectors. If you need help with finding the right kit, our customer support will gladly help you via live chat, email or phone.

1,026,915 Products
Data Quality
  • 2026
  • 1026915
  • 1005
  • 297
  • 290
  • 253
  • 242
  • 403781
  • 335491
  • 197298
  • 19989
  • 18117
  • 689352
  • 298383
  • 39144
  • 36
  • 779663
    Mammalian Expression Vector
  • 565437
  • 247252
    Bacterial Expression Vector
  • 161879
  • 87096
Vector Backbone
  • 108734
  • 62463
  • 62462
  • 62462
  • 62461
Fusion tag
  • 210142
  • 216580
  • 93600
  • 91625
  • 61225
Resistance Gene
  • 767687
  • 259228
Selectable Marker
  • 370007
  • 179829
  • 57
  • 401032
  • 365922
  • 264117
  • 39145
  • 3184
Expression Type
  • 596639
  • 427080
  • 68536
  • 3174
  • 10
  • 740484
  • 366219
  • 39144
  • 27
  • 26
  • 494623
  • 413330
  • 118960
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Protein Expression
SRY (Sex Determining Region Y)-Box 9 (SOX9)
NCBI Accession:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Uncoupling Protein 2 (Mitochondrial, Proton Carrier) (UCP2)
NCBI Accession:
PTRG_09289, UCP2, LOC100282746, ucp2.L, ucp2, ucp1, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Protein Expression
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
KLF5, klf5.S, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
Sk1, SPHK1, sphk1.L, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Transient, Stable

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Protein Expression
Speckle-Type POZ Protein (SPOP)
NCBI Accession:
spop, SPOP, Bm1_45730, spop.S, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ribonucleotide Reductase M1 (RRM1)
NCBI Accession:
RRM1, RnrL, LOC100472317, rrm1, rrm1.L, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PLK4 is ideal for over-expression of native protein for functional studies.

Protein Expression
Polo-Like Kinase 4 (PLK4)
NCBI Accession:
SAK, PLK4, Plk4, plk4, LOC5571876
Insert length:
3970 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Wang, Soni, Uryu, Tsou: "The conversion of centrioles to centrosomes: essential coupling of duplication with segregation." in: The Journal of cell biology, Vol. 193, Issue 4, pp. 727-39, 2011 (Pubmed)
Catalog No. ABIN3379451
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLHL1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Kelch-Like 1 (Drosophila) (KLHL1)
NCBI Accession:
KLHL1, Klhl1
Insert length:
4230 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Karlsson, Heddle, Rozkov, Rotticci-Mulder, Tuvesson, Hilgendorf, Andersson et al.: "High-activity p-glycoprotein, multidrug resistance protein 2, and breast cancer resistance protein membrane vesicles prepared from transiently transfected human embryonic kidney 293-epstein-barr ..." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 38, Issue 4, pp. 705-14, 2010 (Pubmed)
Catalog No. ABIN3378610
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATP6V1A is ideal for over-expression of native protein for functional studies.

Protein Expression
ATPase, H+ Transporting, Lysosomal 70kDa, V1 Subunit A (ATP6V1A)
NCBI Accession:
ATP6V1A, atp6v1aa, ANI_1_1468024, AOR_1_602134, atp6v1a.L, Atp6v0a1, Atp6v1a, Vha68-1, vpp3
Insert length:
2880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Adamson, Chohan, Swenson, LaJeunesse: "A Drosophila model for genetic analysis of influenza viral/host interactions." in: Genetics, Vol. 189, Issue 2, pp. 495-506, 2011 (Pubmed)
Catalog No. ABIN3382667
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BACE1 is ideal for over-expression of native protein for functional studies.

Protein Expression
beta-Site APP-Cleaving Enzyme 1 (BACE)
NCBI Accession:
BACE1, Bace1, bace1, bace2.L, bace2.S, bace2, BACE2
Insert length:
3270 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Fisher, Resnick, De, Acevedo, Lu, Schroeder, Nicholson: "Cyclic cis-Locked Phospho-Dipeptides Reduce Entry of AβPP into Amyloidogenic Processing Pathway." in: Journal of Alzheimer's disease : JAD, Vol. 55, Issue 1, pp. 391-410, 2016 (Pubmed)
  • Atkin, Hunt, Minakawa, Sharkey, Tipper, Tennant, Paulson: "F-box only protein 2 (Fbxo2) regulates amyloid precursor protein levels and processing." in: The Journal of biological chemistry, Vol. 289, Issue 10, pp. 7038-48, 2014 (Pubmed)
  • Wang, Wilfred, Madathil, Tang, Hu, Dimayuga, Stromberg, Huang, Saatman, Nelson: "miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease." in: The American journal of pathology, Vol. 177, Issue 1, pp. 334-45, 2010 (Pubmed)
  • Minopoli, Passaro, Aloia, Carlomagno, Melillo, Santoro, Forzati, Zambrano, Russo: "Receptor- and non-receptor tyrosine kinases induce processing of the amyloid precursor protein: role of the low-density lipoprotein receptor-related protein." in: Neuro-degenerative diseases, Vol. 4, Issue 2-3, pp. 94-100, 2007 (Pubmed)
Catalog No. ABIN3382704
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BAD is ideal for over-expression of native protein for functional studies.

Protein Expression
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
badb, BAD, Bad
Insert length:
1110 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Cain, Hauptschein, Stewart, Bagci, Sahagian, Jay: "Identification of CD44 as a surface biomarker for drug resistance by surface proteome signature technology." in: Molecular cancer research : MCR, Vol. 9, Issue 5, pp. 637-47, 2011 (Pubmed)
  • Anderson, Sutherland, Butt: "BAG-1 overexpression attenuates luminal apoptosis in MCF-10A mammary epithelial cells through enhanced RAF-1 activation." in: Oncogene, Vol. 29, Issue 4, pp. 527-38, 2010 (Pubmed)
Catalog No. ABIN3382708
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ALDH2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Aldehyde Dehydrogenase 2 Family (Mitochondrial) (ALDH2)
NCBI Accession:
aldh2.1, aldh2.L, aldh2, ALDH2, RHA1_RS43090, aldH2, OE_RS03015, Aldh2
Insert length:
2100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Keller, Watschinger, Lange, Golderer, Werner-Felmayer, Hermetter, Wanders, Werner: "Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds." in: Journal of lipid research, Vol. 53, Issue 7, pp. 1410-6, 2012 (Pubmed)
Catalog No. ABIN3382447
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BRD7 is ideal for over-expression of native protein for functional studies.

Protein Expression
Bromodomain Containing 7 (BRD7)
NCBI Accession:
brd7.L, brd7, BRD7, Brd7
Insert length:
3200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Tae, Karkhanis, Velasco, Yaneva, Erdjument-Bromage, Tempst, Sif: "Bromodomain protein 7 interacts with PRMT5 and PRC2, and is involved in transcriptional repression of their target genes." in: Nucleic acids research, Vol. 39, Issue 13, pp. 5424-38, 2011 (Pubmed)
Catalog No. ABIN3382797
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Protein Expression
BCL2-Like 1 (BCL2L1)
NCBI Accession:
BCL2L1, Bcl2l1, bcl2l1, bcl2l1.L
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LDB1 is ideal for over-expression of native protein for functional studies.

Protein Expression
LIM Domain Binding 1 (LDB1)
NCBI Accession:
ldb1.L, Ldb1, LDB1, xldb1, ldb1b
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Johnsen, Güngör, Prenzel, Riethdorf, Riethdorf, Taniguchi-Ishigaki, Rau, Tursun, Furlow, Sauter, Scheffner, Pantel, Gannon, Bach: "Regulation of estrogen-dependent transcription by the LIM cofactors CLIM and RLIM in breast cancer." in: Cancer research, Vol. 69, Issue 1, pp. 128-36, 2009 (Pubmed)
Catalog No. ABIN3378659
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EFEMP2 is ideal for over-expression of native protein for functional studies.

Protein Expression
Fibulin 4 (FBLN4)
NCBI Accession:
Efemp2, efemp2b, fbln4, EFEMP2
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • McLaughlin, Chen, Horiguchi, Starcher, Stanton, Broekelmann, Marmorstein, McKay, Mecham, Nakamura, Marmorstein: "Targeted disruption of fibulin-4 abolishes elastogenesis and causes perinatal lethality in mice." in: Molecular and cellular biology, Vol. 26, Issue 5, pp. 1700-9, 2006 (Pubmed)
Catalog No. ABIN3377844
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PURA is ideal for over-expression of native protein for functional studies.

Protein Expression
Purine-Rich Element Binding Protein A (PURA)
NCBI Accession:
pura, Pura, PURA, puraa, pura.L
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3379641
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RING1 is ideal for over-expression of native protein for functional studies.

Protein Expression
Ring Finger Protein 1 (RING1)
NCBI Accession:
RING1, Ring1
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Meng, Zhou, Gu, Chanda, Ospino, Cooke: "Transdifferentiation Requires iNOS Activation: Role of RING1A S-Nitrosylation." in: Circulation research, Vol. 119, Issue 9, pp. e129-e138, 2016 (Pubmed)
Catalog No. ABIN3379791
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCNN1B is ideal for over-expression of native protein for functional studies.

Protein Expression
Sodium Channel, Nonvoltage-Gated 1, beta (SCNN1B)
NCBI Accession:
SCNN1B, scnn1b, Scnn1b
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Kim, Son, Kim, Kweon, Suh, Lyall, Rhyu: "Selective activation of hTRPV1 by N-geranyl cyclopropylcarboxamide, an amiloride-insensitive salt taste enhancer." in: PLoS ONE, Vol. 9, Issue 2, pp. e89062, 2014 (Pubmed)
  • Araki, Umemura, Miyagi, Yabana, Miki, Tamura, Uchino, Aoki, Goshima, Umemura, Ishigami: "Expression, transcription, and possible antagonistic interaction of the human Nedd4L gene variant: implications for essential hypertension." in: Hypertension (Dallas, Tex. : 1979), Vol. 51, Issue 3, pp. 773-7, 2008 (Pubmed)
Catalog No. ABIN3379906
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Protein Expression
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
  • Zhou, Wang, Schwartz, Stoffels, Park, Zhang, Yang, Demirkaya, Takeuchi, Tsai, Lyons, Yu, Ouyang, Chen, Chin, Zaal, Chandrasekharappa, P Hanson, Yu, Mullikin, Hasni, Wertz, Ombrello, Stone, Hoffmann et al.: "Loss-of-function mutations in TNFAIP3 leading to A20 haploinsufficiency cause an early-onset autoinflammatory disease. ..." in: Nature genetics, Vol. 48, Issue 1, pp. 67-73, 2015 (Pubmed)
  • Palamarchuk, Efanov, Nazaryan, Santanam, Alder, Rassenti, Kipps, Croce, Pekarsky: "13q14 deletions in CLL involve cooperating tumor suppressors." in: Blood, Vol. 115, Issue 19, pp. 3916-22, 2010 (Pubmed)
Catalog No. ABIN3380443
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...