Plasmids

A plasmid is a small, circular, double-stranded DNA molecule within a cell that can replicate independently and is not not packaged inside a chromosome . They are common in bacteria and can sometimes be found in archaea or eukaryotic organisms aswell. Plasmid are of great use in biotechnology, they serve as vectors to amplify or express genetic information in foreign hosts. These plasmids will typically contain a multiple cloning site (MCS) to insert the desired sequence, an origin of replication (ORI) to duplicate in the host and selection mechanisms (e.g. antibiotic resistance) to verify the insertion process. The cloning vector is transferred into a robust host (e.g. E.coli) via transformation and greatly amplified within each cell.

Upon lysis the vector can be transferred to an expression vector. They contain an additional promoter sequence which encourage the local transcriptional machinery to transcribe an RNA template in order to produce the protein of interest.

Choose at genomics-online between different types of plasmid inserts. We provide you with ready-to-use shRNA Clones, ORF Clones, cDNA Clones and those specialized on the CRISPR/CAS9 system. For further questions regarding our products, please contact our customer service via phone, live chat, or email.

1,896,182 Products
Data Quality
  • 3015
Type
  • 1896182
    Plasmid
Gene
  • 1031
  • 382
  • 377
  • 345
  • 329
Species
  • 819086
  • 583910
  • 387828
  • 27772
  • 21907
Insert
  • 785880
  • 437352
  • 365415
  • 154625
  • 114972
Vector
  • 779663
  • 565437
  • 247252
  • 161879
  • 87096
Vector Backbone
  • 149568
  • 115473
  • 114972
  • 108734
  • 62463
Fusion tag
  • 636531
  • 216580
  • 187467
  • 183643
  • 135728
Resistance Gene
  • 846784
  • 799412
  • 215404
  • 37846
  • 34916
Selectable Marker
  • 518849
  • 514139
  • 179829
  • 14372
  • 9554
Promoter
  • 485441
  • 449901
  • 410579
  • 264117
  • 153319
Expression Type
  • 1264652
  • 652554
  • 486383
  • 3174
  • 10
Application
  • 1094805
  • 477852
  • 365415
  • 307515
  • 59
Format
  • 743678
  • 494623
  • 349110
  • 308708
Supplier: Log in to see

Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
SRY (Sex Determining Region Y)-Box 9 (SOX9)
NCBI Accession:
NM_000346,NP_000337
Species:
Human
Synonyms:
SOX9, LOC100227849, SOX10, Sox9
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Luanpitpong, Li, Manke, Brundage, Ellis, McLaughlin, Angsutararux, Chanthra, Voronkova, Chen, Wang, Chanvorachote, Pei, Issaragrisil, Rojanasakul: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, 2016 (Pubmed)
  • Shakhova, Cheng, Mishra, Zingg, Schaefer, Debbache, Häusel, Matter, Guo, Davis, Meltzer, Mihic-Probst, Moch, Wegner, Merlino, Levesque, Dummer, Santoro, Cinelli, Sommer: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, 2015 (Pubmed)
  • Ikhapoh, Pelham, Agrawal: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, 2015 (Pubmed)
  • Matsushima, Kuroki, Kitasato, Adachi, Tanaka, Hirabaru, Hirayama, Kuroshima, Hidaka, Soyama, Takatsuki, Kinoshita, Sano, Nishida, Eguchi: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, 2015 (Pubmed)
  • Bobick, Alexander, Tuan: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, 2014 (Pubmed)
  • Needham, Shah, Dahlin, Kinard, Lam, Watson, Lu, Kasper, Mikos: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, 2014 (Pubmed)
  • Mata-Rocha, Hernández-Sánchez, Guarneros, de la Chesnaye, Sánchez-Tusié, Treviño, Felix, Oviedo: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, 2014 (Pubmed)
  • Show more References
Catalog No. ABIN3319363
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human UCP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Uncoupling Protein 2 (Mitochondrial, Proton Carrier) (UCP2)
NCBI Accession:
NM_003355,NP_003346
Species:
Human
Synonyms:
PTRG_09289, UCP2, LOC100282746, ucp2.L, ucp2, ucp1, Ucp2
Insert length:
1660 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fiorini, Cordani, Gotte, Picone, Donadelli: "Onconase induces autophagy sensitizing pancreatic cancer cells to gemcitabine and activates Akt/mTOR pathway in a ROS-dependent manner." in: Biochimica et biophysica acta, Vol. 1853, Issue 3, pp. 549-60, 2015 (Pubmed)
Catalog No. ABIN3318600
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLF5 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kruppel-Like Factor 5 (Intestinal) (KLF5)
NCBI Accession:
NM_001730,NP_001721
Species:
Human
Synonyms:
KLF5, klf5.S, Klf5
Insert length:
1700 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Yang, Nakagawa, Tetreault, Billig, Victor, Goyal, Sepulveda, Katz: "Loss of transcription factor KLF5 in the context of p53 ablation drives invasive progression of human squamous cell cancer." in: Cancer research, Vol. 71, Issue 20, pp. 6475-84, 2011 (Pubmed)
Catalog No. ABIN3317771
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPHK1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine Kinase 1 (SPHK1)
NCBI Accession:
NM_021972,NP_068807
Species:
Human
Synonyms:
Sk1, SPHK1, sphk1.L, Sphk1
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Jiang, Smith, Li, Rao, Liu, Donahue, Wang, Turner: "Sphingosine kinase 1 overexpression stimulates intestinal epithelial cell proliferation through increased c-Myc translation." in: American journal of physiology. Cell physiology, Vol. 304, Issue 12, pp. C1187-97, 2013 (Pubmed)
  • Antoon, White, Driver, Burow, Beckman: "Sphingosine kinase isoforms as a therapeutic target in endocrine therapy resistant luminal and basal-A breast cancer." in: Experimental biology and medicine (Maywood, N.J.), Vol. 237, Issue 7, pp. 832-44, 2012 (Pubmed)
Catalog No. ABIN3318318
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SPOP is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Speckle-Type POZ Protein (SPOP)
NCBI Accession:
NM_003563,NP_003554
Species:
Human
Synonyms:
spop, SPOP, Bm1_45730, spop.S, Spop
Insert length:
2430 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Lutz, Pace, Arnold: "Rotavirus NSP1 Associates with Components of the Cullin RING Ligase Family of E3 Ubiquitin Ligases." in: Journal of virology, Vol. 90, Issue 13, pp. 6036-48, 2016 (Pubmed)
Catalog No. ABIN3386943
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RRM1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ribonucleotide Reductase M1 (RRM1)
NCBI Accession:
NM_001033,NP_001024
Species:
Human
Synonyms:
RRM1, RnrL, LOC100472317, rrm1, rrm1.L, Rrm1
Insert length:
2930 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Xie, Yen, Owonikoko, Ramalingam, Khuri, Curran, Doetsch, Deng: "Bcl2 induces DNA replication stress by inhibiting ribonucleotide reductase." in: Cancer research, Vol. 74, Issue 1, pp. 212-23, 2014 (Pubmed)
Catalog No. ABIN3386533
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PLK4 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Polo-Like Kinase 4 (PLK4)
NCBI Accession:
NM_014264,NP_055079
Species:
Human
Synonyms:
SAK, PLK4, Plk4, plk4, LOC5571876
Insert length:
3970 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Wang, Soni, Uryu, Tsou: "The conversion of centrioles to centrosomes: essential coupling of duplication with segregation." in: The Journal of cell biology, Vol. 193, Issue 4, pp. 727-39, 2011 (Pubmed)
Catalog No. ABIN3379451
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human KLHL1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Kelch-Like 1 (Drosophila) (KLHL1)
NCBI Accession:
NM_020866,NP_065917
Species:
Human
Synonyms:
KLHL1, Klhl1
Insert length:
4230 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Karlsson, Heddle, Rozkov, Rotticci-Mulder, Tuvesson, Hilgendorf, Andersson et al.: "High-activity p-glycoprotein, multidrug resistance protein 2, and breast cancer resistance protein membrane vesicles prepared from transiently transfected human embryonic kidney 293-epstein-barr ..." in: Drug metabolism and disposition: the biological fate of chemicals, Vol. 38, Issue 4, pp. 705-14, 2010 (Pubmed)
Catalog No. ABIN3378610
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ATP6V1A is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
ATPase, H+ Transporting, Lysosomal 70kDa, V1 Subunit A (ATP6V1A)
NCBI Accession:
NM_001690,NP_001681
Species:
Human
Synonyms:
ATP6V1A, atp6v1aa, ANI_1_1468024, AOR_1_602134, atp6v1a.L, Atp6v0a1, Atp6v1a, Vha68-1, vpp3
Insert length:
2880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Adamson, Chohan, Swenson, LaJeunesse: "A Drosophila model for genetic analysis of influenza viral/host interactions." in: Genetics, Vol. 189, Issue 2, pp. 495-506, 2011 (Pubmed)
Catalog No. ABIN3382667
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BACE1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
beta-Site APP-Cleaving Enzyme 1 (BACE)
NCBI Accession:
NM_012104,NP_036236
Species:
Human
Synonyms:
BACE1, Bace1, bace1, bace2.L, bace2.S, bace2, BACE2
Insert length:
3270 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fisher, Resnick, De, Acevedo, Lu, Schroeder, Nicholson: "Cyclic cis-Locked Phospho-Dipeptides Reduce Entry of AβPP into Amyloidogenic Processing Pathway." in: Journal of Alzheimer's disease : JAD, Vol. 55, Issue 1, pp. 391-410, 2016 (Pubmed)
  • Atkin, Hunt, Minakawa, Sharkey, Tipper, Tennant, Paulson: "F-box only protein 2 (Fbxo2) regulates amyloid precursor protein levels and processing." in: The Journal of biological chemistry, Vol. 289, Issue 10, pp. 7038-48, 2014 (Pubmed)
  • Wang, Wilfred, Madathil, Tang, Hu, Dimayuga, Stromberg, Huang, Saatman, Nelson: "miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease." in: The American journal of pathology, Vol. 177, Issue 1, pp. 334-45, 2010 (Pubmed)
  • Minopoli, Passaro, Aloia, Carlomagno, Melillo, Santoro, Forzati, Zambrano, Russo: "Receptor- and non-receptor tyrosine kinases induce processing of the amyloid precursor protein: role of the low-density lipoprotein receptor-related protein." in: Neuro-degenerative diseases, Vol. 4, Issue 2-3, pp. 94-100, 2007 (Pubmed)
Catalog No. ABIN3382704
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BAD is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Associated Agonist of Cell Death (BAD)
NCBI Accession:
NM_004322,NP_004313
Species:
Human
Synonyms:
badb, BAD, Bad
Insert length:
1110 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Cain, Hauptschein, Stewart, Bagci, Sahagian, Jay: "Identification of CD44 as a surface biomarker for drug resistance by surface proteome signature technology." in: Molecular cancer research : MCR, Vol. 9, Issue 5, pp. 637-47, 2011 (Pubmed)
  • Anderson, Sutherland, Butt: "BAG-1 overexpression attenuates luminal apoptosis in MCF-10A mammary epithelial cells through enhanced RAF-1 activation." in: Oncogene, Vol. 29, Issue 4, pp. 527-38, 2010 (Pubmed)
Catalog No. ABIN3382708
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human ALDH2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Aldehyde Dehydrogenase 2 Family (Mitochondrial) (ALDH2)
NCBI Accession:
NM_000690,NP_000681
Species:
Human
Synonyms:
aldh2.1, aldh2.L, aldh2, ALDH2, RHA1_RS43090, aldH2, OE_RS03015, Aldh2
Insert length:
2100 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Keller, Watschinger, Lange, Golderer, Werner-Felmayer, Hermetter, Wanders, Werner: "Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds." in: Journal of lipid research, Vol. 53, Issue 7, pp. 1410-6, 2012 (Pubmed)
Catalog No. ABIN3382447
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BRD7 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Bromodomain Containing 7 (BRD7)
NCBI Accession:
NM_013263,NP_037395
Species:
Human
Synonyms:
brd7.L, brd7, BRD7, Brd7
Insert length:
3200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tae, Karkhanis, Velasco, Yaneva, Erdjument-Bromage, Tempst, Sif: "Bromodomain protein 7 interacts with PRMT5 and PRC2, and is involved in transcriptional repression of their target genes." in: Nucleic acids research, Vol. 39, Issue 13, pp. 5424-38, 2011 (Pubmed)
Catalog No. ABIN3382797
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human BCL2L1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
BCL2-Like 1 (BCL2L1)
NCBI Accession:
NM_138578,NP_612815
Species:
Human
Synonyms:
BCL2L1, Bcl2l1, bcl2l1, bcl2l1.L
Insert length:
2380 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Fouqué, Lepvrier, Debure, Gouriou, Malleter, Delcroix, Ovize, Ducret, Li, Hammadi, Vacher, Legembre: "The apoptotic members CD95, BclxL, and Bcl-2 cooperate to promote cell migration by inducing Ca(2+) flux from the endoplasmic reticulum to mitochondria." in: Cell death and differentiation, Vol. 23, Issue 10, pp. 1702-16, 2016 (Pubmed)
Catalog No. ABIN3382739
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human LDB1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
LIM Domain Binding 1 (LDB1)
NCBI Accession:
NM_003893,NP_003884
Species:
Human
Synonyms:
ldb1.L, Ldb1, LDB1, xldb1, ldb1b
Insert length:
1900 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Johnsen, Güngör, Prenzel, Riethdorf, Riethdorf, Taniguchi-Ishigaki, Rau, Tursun, Furlow, Sauter, Scheffner, Pantel, Gannon, Bach: "Regulation of estrogen-dependent transcription by the LIM cofactors CLIM and RLIM in breast cancer." in: Cancer research, Vol. 69, Issue 1, pp. 128-36, 2009 (Pubmed)
Catalog No. ABIN3378659
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human EFEMP2 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Fibulin 4 (FBLN4)
NCBI Accession:
NM_016938,NP_058634
Species:
Human
Synonyms:
Efemp2, efemp2b, fbln4, EFEMP2
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • McLaughlin, Chen, Horiguchi, Starcher, Stanton, Broekelmann, Marmorstein, McKay, Mecham, Nakamura, Marmorstein: "Targeted disruption of fibulin-4 abolishes elastogenesis and causes perinatal lethality in mice." in: Molecular and cellular biology, Vol. 26, Issue 5, pp. 1700-9, 2006 (Pubmed)
Catalog No. ABIN3377844
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human PURA is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Purine-Rich Element Binding Protein A (PURA)
NCBI Accession:
NM_005859,NP_005850
Species:
Human
Synonyms:
pura, Pura, PURA, puraa, pura.L
Insert length:
1500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Moldovan, Moran: "The Zinc-Finger Antiviral Protein ZAP Inhibits LINE and Alu Retrotransposition." in: PLoS genetics, Vol. 11, Issue 5, pp. e1005121, 2015 (Pubmed)
Catalog No. ABIN3379641
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human RING1 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Ring Finger Protein 1 (RING1)
NCBI Accession:
NM_002931,NP_002922
Species:
Human
Synonyms:
RING1, Ring1
Insert length:
2000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Meng, Zhou, Gu, Chanda, Ospino, Cooke: "Transdifferentiation Requires iNOS Activation: Role of RING1A S-Nitrosylation." in: Circulation research, Vol. 119, Issue 9, pp. e129-e138, 2016 (Pubmed)
Catalog No. ABIN3379791
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human SCNN1B is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
Sodium Channel, Nonvoltage-Gated 1, beta (SCNN1B)
NCBI Accession:
NM_000336,NP_000327
Species:
Human
Synonyms:
SCNN1B, scnn1b, Scnn1b
Insert length:
2500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Kim, Son, Kim, Kweon, Suh, Lyall, Rhyu: "Selective activation of hTRPV1 by N-geranyl cyclopropylcarboxamide, an amiloride-insensitive salt taste enhancer." in: PLoS ONE, Vol. 9, Issue 2, pp. e89062, 2014 (Pubmed)
  • Araki, Umemura, Miyagi, Yabana, Miki, Tamura, Uchino, Aoki, Goshima, Umemura, Ishigami: "Expression, transcription, and possible antagonistic interaction of the human Nedd4L gene variant: implications for essential hypertension." in: Hypertension (Dallas, Tex. : 1979), Vol. 51, Issue 3, pp. 773-7, 2008 (Pubmed)
Catalog No. ABIN3379906
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
Supplier: Log in to see

Untagged full-length cDNA clone from Human TRAF6 is ideal for over-expression of native protein for functional studies.

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 6 (TRAF6)
NCBI Accession:
NM_145803,NP_665802
Species:
Human
Synonyms:
traf6.L, Traf6, TRAF6, traf6, LOC551819
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Zhou, Wang, Schwartz, Stoffels, Park, Zhang, Yang, Demirkaya, Takeuchi, Tsai, Lyons, Yu, Ouyang, Chen, Chin, Zaal, Chandrasekharappa, P Hanson, Yu, Mullikin, Hasni, Wertz, Ombrello, Stone, Hoffmann et al.: "Loss-of-function mutations in TNFAIP3 leading to A20 haploinsufficiency cause an early-onset autoinflammatory disease. ..." in: Nature genetics, Vol. 48, Issue 1, pp. 67-73, 2015 (Pubmed)
  • Palamarchuk, Efanov, Nazaryan, Santanam, Alder, Rassenti, Kipps, Croce, Pekarsky: "13q14 deletions in CLL involve cooperating tumor suppressors." in: Blood, Vol. 115, Issue 19, pp. 3916-22, 2010 (Pubmed)
Catalog No. ABIN3380443
$190.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 11 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...