Plasmids

A plasmid is a small, circular, double-stranded DNA molecule within a cell that can replicate independently and is not not packaged inside a chromosome . They are common in bacteria and can sometimes be found in archaea or eukaryotic organisms aswell. Plasmid are of great use in biotechnology, they serve as vectors to amplify or express genetic information in foreign hosts. These plasmids will typically contain a multiple cloning site (MCS) to insert the desired sequence, an origin of replication (ORI) to duplicate in the host and selection mechanisms (e.g. antibiotic resistance) to verify the insertion process. The cloning vector is transferred into a robust host (e.g. E.coli) via transformation and greatly amplified within each cell.

Upon lysis the vector can be transferred to an expression vector. They contain an additional promoter sequence which encourage the local transcriptional machinery to transcribe an RNA template in order to produce the protein of interest.

Choose at genomics-online between different types of plasmid inserts. We provide you with ready-to-use shRNA Clones, ORF Clones, cDNA Clones and those specialized on the CRISPR/CAS9 system. For further questions regarding our products, please contact our customer service via phone, live chat, or email.

2,112,321 Products
Data Quality
  • 3006
  • 2179
Type
  • 2112321
    Plasmid
Gene
  • 960
  • 453
  • 444
  • 409
  • 375
Species
  • 877742
  • 704138
  • 425222
  • 27759
  • 21907
Application
  • 1262380
  • 535094
  • 356740
  • 307512
  • 59
Fusion tag
  • 692503
  • 308740
  • 219834
  • 216654
  • 137624
Vector Backbone
  • 126288
  • 125786
  • 115473
  • 114972
  • 108654
Vector
  • 817788
  • 683683
  • 248813
  • 161839
  • 145413
Insert
  • 786661
  • 661372
  • 356739
  • 154622
  • 114972
Resistance Gene
  • 888882
  • 748042
  • 383479
  • 92252
  • 37890
Expression Type
  • 1792148
  • 950824
  • 178318
  • 6366
Selectable Marker
  • 555539
  • 468955
  • 178553
  • 14371
  • 9555
Promoter
  • 659369
  • 564512
  • 408353
  • 264871
  • 153363
Format
  • 831401
  • 553754
  • 418397
  • 308706

Type:
ORF
Application:
Cloning
Gene:
Parathyroid Hormone 1 Receptor (PTH1R)
Species:
Human
Synonyms:
PTH1R, Pth1r, pth1ra
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5727979
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
TAR DNA Binding Protein (TARDBP)
Species:
Human
Synonyms:
TARDBP, tardbp, tardbp.L, Tardbp, LOC100621383
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5729920
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ataxia Telangiectasia Mutated (ATM)
Species:
Human
Synonyms:
tefu, atm.L, atm, ATM, EDI_100660, CpipJ_CPIJ001772, BDBG_08252, PAAG_02532, MCYG_05088, VDBG_06833, ACLA_015700, LOC5565620, MGYG_07634, PGTG_14279, Atm
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5720561
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Chromosome 6 Open Reading Frame 150 (C6orf150)
Species:
Human
Synonyms:
MB21D1, CGAS
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734163
$70.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot1
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680322
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot2
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680323
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Bacterial Expression Vector
Vector backbone:
pSpot4
Resistance Gene:
Ampicillin
Promoter:
T7 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680325
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot5
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680326
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot6
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680327
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot7
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680328
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
Empty
Application:
Cloning, Protein Extraction
Vector type:
Yeast Expression Vector
Vector backbone:
pSpot8
Resistance Gene:
Ampicillin
Selection Marker:
Leucin
Promoter:
TPI1 Promoter
Fusion Tag:
Spot-Tag
Expression:
Transient, Stable

Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5680329
$70.63
1.25 μg
Plus shipping costs $45.00
Delivery in 5 to 6 Business Days

Type:
ORF
Application:
Cloning
Gene:
Canopy 2 Homolog (Zebrafish) (CNPY2)
Species:
Human
Synonyms:
CNPY2, Cnpy2, cnpy2, cnpy2.S
Insert length:
549 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5749095
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Interleukin 12b (IL12B)
Species:
Human
Synonyms:
IL12B, Il12b, il12ba
Insert length:
987 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5734406
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Colony Stimulating Factor 1 (Macrophage) (CSF1)
Species:
Human
Synonyms:
CSF1, Csf1, csf1a, LOC396599
Insert length:
1665 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5741106
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caveolin 2 (CAV2)
NCBI Accession:
NM_001233,NP_001224
Species:
Human
Synonyms:
CAV2, Cav2, cav2.L, cav2, LOC100093133, cav-2
Insert length:
489 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343292
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Caveolin 2 (CAV2)
NCBI Accession:
NM_198212,NP_937855
Species:
Human
Synonyms:
CAV2, Cav2, cav2.L, cav2, LOC100093133, cav-2
Insert length:
339 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343293
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cell Cycle Exit and Neuronal Differentiation 1 (CEND1)
NCBI Accession:
NM_016564,NP_057648
Species:
Human
Synonyms:
CEND1, Cend1
Insert length:
450 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343308
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Cell Division Cycle Associated 5 (CDCA5)
NCBI Accession:
NM_080668,NP_542399
Species:
Human
Synonyms:
CDCA5, Cdca5, cdca5, cdca5.S
Insert length:
759 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343326
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Heat Shock 10kDa Protein 1 (Chaperonin 10) (HSPE1)
NCBI Accession:
NM_002157,NP_002148
Species:
Human
Synonyms:
HSPE1, groES, groES2, TP01_0190, Cag_1167, Bm1_56470, Hspe1, hspe1, hspe1.L, LOC452179, Cpn10, CPN10, HSP10, CG11267, hsp10, groS
Insert length:
309 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343417
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Chromosome 6 Open Reading Frame 64 (C6orf64)
NCBI Accession:
NM_018322,NP_060792
Species:
Human
Synonyms:
saysd1
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5343767
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...