Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
437,352 Products
Data Quality
  • 1
Type
  • 437352
    Plasmid
Gene
  • 997
  • 197
  • 170
  • 161
  • 139
Species
  • 294509
  • 64807
  • 60176
  • 5988
  • 3338
Insert
  • 785880
  • 437352
    ORF
  • 365415
  • 154625
  • 114972
Vector
  • 298383
  • 93526
  • 45442
  • 1
Vector Backbone
  • 54421
  • 42128
  • 41851
  • 33867
  • 30289
Fusion tag
  • 60848
  • 96574
  • 75718
  • 59918
  • 29190
Resistance Gene
  • 229258
  • 89199
  • 83979
  • 34916
Selectable Marker
  • 179802
  • 64160
  • 9547
Promoter
  • 202502
  • 189407
Expression Type
  • 212295
  • 179593
  • 73895
Application
  • 422239
  • 15113
Format
  • 397475
  • 39877
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human growth hormone receptor (GHR) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
Growth Hormone Receptor (GHR)
NCBI Accession:
NM_000163,NP_000154
Species:
Human
Synonyms:
GHR, Ghr, ghr.L, ghr
Insert length:
1917 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350683
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human G protein-coupled receptor 174 (GPR174) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
G Protein-Coupled Receptor 174 (GPR174)
NCBI Accession:
NM_032553,NP_115942
Species:
Human
Synonyms:
Gpr174, GPR174
Insert length:
1002 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5349296
$620.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human ATPase, Ca++ transporting, plasma membrane 1 (ATP2B1) transcript variant 1, C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
ATPase, Ca++ Transporting, Plasma Membrane 1 (ATP2B1)
NCBI Accession:
NM_001001323,NP_001001323
Species:
Human
Synonyms:
ATP2B1, atp2b1, LOC100180580, Atp2b1
Insert length:
3531 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337371
$1,810.00
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human ATPase, Ca++ transporting, plasma membrane 1 (ATP2B1) transcript variant 2, C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
ATPase, Ca++ Transporting, Plasma Membrane 1 (ATP2B1)
NCBI Accession:
NM_001682,NP_001673
Species:
Human
Synonyms:
ATP2B1, atp2b1, LOC100180580, Atp2b1
Insert length:
3663 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337370
$1,870.00
10 μg
Plus shipping costs $45.00
Will be delivered in 36 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human laminin, alpha 5 (LAMA5) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
Laminin, alpha 5 (LAMA5)
NCBI Accession:
NM_005560,NP_005551
Species:
Human
Synonyms:
LAMA5, lama5, Lama5
Insert length:
11088 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5354530
$2,000.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human ATP-binding cassette, sub-family B (MDR/TAP), member 11 (ABCB11) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family B (MDR/TAP), Member 11 (ABCB11)
NCBI Accession:
NM_003742,NP_003733
Species:
Human
Synonyms:
ABCB11, LOC100489744, LOC100565276, EDI_111220, EDI_272930, abcb11, Abcb11
Insert length:
4038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391336
$2,000.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR) , C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
Cystic Fibrosis Transmembrane Conductance Regulator (ATP-Binding Cassette Sub-Family C, Member 7) (CFTR)
NCBI Accession:
NM_000492,NP_000483
Species:
Human
Synonyms:
CFTR, cftr-A, Cftr, cftr
Insert length:
4515 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391458
$2,000.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Lentiviral Vector with ORF clone of Human sodium channel, voltage gated, type VIII, alpha subunit (SCN8A) transcript variant 1, C-term Myc-DDK-tagged

Type:
ORF
Application:
Protein Expression
Gene:
Sodium Channel, Voltage-Gated, Type VIII, alpha (SCN8A)
NCBI Accession:
NM_014191,NP_055006
Species:
Human
Synonyms:
SCN8A, Scn8a
Insert length:
5943 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-Myc-DDK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Stable, Transient

Empty vector controls:
ABIN4948180

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5457394
$2,000.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human CNDP dipeptidase 2 (metallopeptidase M20 family) (CNDP2) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
CNDP Dipeptidase 2 (Metallopeptidase M20 Family) (CNDP2)
NCBI Accession:
NM_018235,NP_060705
Species:
Human
Synonyms:
Cndp2, CNDP2, cndp2, cndp2.S, cndp2.L, pep1
Insert length:
1428 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5342299
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human microsomal glutathione S-transferase 1 (MGST1) transcript variant 1b

Type:
ORF
Application:
Protein Expression
Gene:
Microsomal Glutathione S-Transferase 1 (MGST1)
NCBI Accession:
NM_020300,NP_064696
Species:
Human
Synonyms:
mgst1.L, mgst1.1, LOC473380, MGST1, mgst1, CpipJ_CPIJ015233, CpipJ_CPIJ018241, Mgst1
Insert length:
468 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350541
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human guanylate cyclase activator 2A (guanylin) (GUCA2A)

Type:
ORF
Application:
Protein Expression
Gene:
Guanylate Cyclase Activator 2A (Guanylin) (GUCA2A)
NCBI Accession:
NM_033553,NP_291031
Species:
Human
Synonyms:
GUCA2A, guc2a, Guca2a, LOC100625184
Insert length:
348 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350769
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human heat shock 22kDa protein 8 (HSPB8)

Type:
ORF
Application:
Protein Expression
Gene:
Heat Shock 22kDa Protein 8 (HSPB8)
NCBI Accession:
NM_014365,NP_055180
Species:
Human
Synonyms:
hspb8.L, HSPB8, hspb8, Hspb8
Insert length:
591 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350784
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human heart and neural crest derivatives expressed 1 (HAND1)

Type:
ORF
Application:
Protein Expression
Gene:
Heart and Neural Crest Derivatives Expressed 1 (HAND1)
NCBI Accession:
NM_004821,NP_004812
Species:
Human
Synonyms:
CTSG, HAND1, Hand1, hand1.L, hand1
Insert length:
648 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350806
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human Rac GTPase activating protein 1 (RACGAP1) transcript variant 2

Type:
ORF
Application:
Protein Expression
Gene:
Rac GTPase Activating Protein 1 (RACGAP1)
NCBI Accession:
NM_001126103,NP_001119575
Species:
Human
Synonyms:
racgap1, racgap1.2.L, RACGAP1, racgap1.2, racgap1.L, Racgap1
Insert length:
1899 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350149
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human Rac GTPase activating protein 1 (RACGAP1) transcript variant 3

Type:
ORF
Application:
Protein Expression
Gene:
Rac GTPase Activating Protein 1 (RACGAP1)
NCBI Accession:
NM_001126104,NP_001119576
Species:
Human
Synonyms:
racgap1, racgap1.2.L, RACGAP1, racgap1.2, racgap1.L, Racgap1
Insert length:
1899 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350150
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human lipase, gastric (LIPF) transcript variant 4

Type:
ORF
Application:
Protein Expression
Gene:
Lipase, Gastric (LIPF)
NCBI Accession:
NM_001198830,NP_001185759
Species:
Human
Synonyms:
lipf, LIPF, LOC100394535, Lipf
Insert length:
1128 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350253
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human gastrin (GAST)

Type:
ORF
Application:
Protein Expression
Gene:
Gastrin (GAST)
NCBI Accession:
NM_000805,NP_000796
Species:
Human
Synonyms:
GAST, Gast
Insert length:
306 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350267
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human growth hormone releasing hormone (GHRH) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
Growth Hormone Releasing Hormone (GHRH)
NCBI Accession:
NM_021081,NP_066567
Species:
Human
Synonyms:
ghrh, GHRH, Ghrh, LOC780526
Insert length:
327 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5349661
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human GLI family zinc finger 1 (GLI1) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
Zinc Finger Protein GLI1 (GLI1)
NCBI Accession:
NM_005269,NP_005260
Species:
Human
Synonyms:
GLI1, Gli1, gli1.S, gli1
Insert length:
3321 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5349750
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
Supplier: Log in to see

Mammalian Vector with ORF clone of Human growth hormone 2 (GH2) transcript variant 1

Type:
ORF
Application:
Protein Expression
Gene:
Growth Hormone 2 (GH2)
NCBI Accession:
NM_002059,NP_002050
Species:
Human
Synonyms:
GH2
Insert length:
654 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5350659
$158.00
10 μg
Plus shipping costs $45.00
Will be delivered in 8 to 10 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...