Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
437,352 Products
Data Quality
  • 1
Type
  • 437352
    Plasmid
Gene
  • 997
  • 197
  • 170
  • 161
  • 139
Species
  • 294509
  • 64807
  • 60176
  • 5988
  • 3338
Insert
  • 785880
  • 437352
    ORF
  • 365415
  • 154625
  • 114972
Vector
  • 298383
  • 93526
  • 45442
  • 1
Vector Backbone
  • 54421
  • 42128
  • 41851
  • 33867
  • 30289
Fusion tag
  • 60848
  • 96574
  • 75718
  • 59918
  • 29190
Resistance Gene
  • 229258
  • 89199
  • 83979
  • 34916
Selectable Marker
  • 179802
  • 64102
  • 9547
Promoter
  • 202502
  • 189407
Expression Type
  • 202703
  • 189185
  • 64303
Application
  • 422239
  • 15113
Format
  • 397475
  • 39877
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10 (CXCL10)
NCBI Accession:
NM_001565
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981002
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10 (CXCL10)
NCBI Accession:
NM_001565
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981003
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 5 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 5 (CXCL5)
NCBI Accession:
NM_009141
Species:
Mouse (Murine)
Synonyms:
CXCL5, Cxcl6, LOC701946, LOC703222, Cxcl5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981276
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens agouti related protein homolog (mouse) (AGRP), transcript variant 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Agouti Related Protein Homolog (Mouse) (AGRP)
NCBI Accession:
NM_001138
Species:
Human
Synonyms:
AGRP, Agrp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615000
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
6-phosphofructo-2-Kinase/fructose-2,6-Biphosphatase 4 (PFKFB4)
NCBI Accession:
NM_004567
Species:
Human
Synonyms:
pfkfb4, pfkfb4.S, PFKFB4, pfkfb4a, f264, Pfkfb4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629245
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

ORF Clone of Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa), transcript variant 3 DNA.

Type:
ORF
Application:
Protein Expression
Gene:
Cell Division Cycle 42 (GTP Binding Protein, 25kDa) (CDC42)
NCBI Accession:
NM_001039802
Species:
Human
Synonyms:
CDC42, Cdc42, cdc42l, LOC100392513, cdc42, LOC745248, LOC100636735, LOC100637699, LOC100638834, cdc42.L, LOC607535
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3972417
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cyclin-dependent kinase 2 ,transcript variant 1 with HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cyclin-Dependent Kinase 2 (CDK2)
NCBI Accession:
NM_001798
Species:
Human
Synonyms:
CDK2, cinp, CINP, cinp.S, Cdk2, cdk2, cdk2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948153

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3973029
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens secreted frizzled-related protein 4 with His tag.

Type:
ORF
Application:
Protein Expression
Gene:
Secreted Frizzled-Related Protein 4 (SFRP4)
NCBI Accession:
NM_003014
Species:
Human
Synonyms:
SFRP4, Sfrp4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-His
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948154

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3584450
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens WNT inhibitory factor 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
WNT Inhibitory Factor 1 (WIF1)
NCBI Accession:
NM_007191
Species:
Human
Synonyms:
LOC552805, CpipJ_CPIJ003761, wif1, WIF1, Wif1, LOC100511326, wif1.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3574506
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus wingless-related MMTV integration site 5A with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Wingless-Type MMTV Integration Site Family, Member 5A (WNT5A)
NCBI Accession:
NM_009524
Species:
Mouse (Murine)
Synonyms:
WNT5A, Wnt5a, wnt5a.S, wnt5a, LOC578814, wnt5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3574771
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens SMAD family member 5 (SMAD5), transcript variant 3 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
SMAD, Mothers Against DPP Homolog 5 (SMAD5)
NCBI Accession:
NM_001001420
Species:
Human
Synonyms:
SMAD5, smad5, smad4.2.S, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3588920
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens adenosylmethionine decarboxylase 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Adenosylmethionine Decarboxylase 1 (AMD1)
NCBI Accession:
NM_001634
Species:
Human
Synonyms:
SamDC, AMD1, amd1, Amd1, amd1.L, sam2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3617477
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 5 with HA tag.

Type:
ORF
Application:
Protein Expression
Gene:
SMAD, Mothers Against DPP Homolog 5 (SMAD5)
NCBI Accession:
NM_008541
Species:
Mouse (Murine)
Synonyms:
SMAD5, smad5, smad4.2.S, Smad5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-HA
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948153

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3588921
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus sirtuin 5 (silent mating type information regulation 2 homolog) 5 (S. cerevisiae) with Myc tag.

Type:
ORF
Application:
Protein Expression
Gene:
Sirtuin 5 (SIRT5)
NCBI Accession:
NM_178848
Species:
Mouse (Murine)
Synonyms:
SIRT5, Sirt5, sirt5, sirt5.L, CC1G_00083
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-Myc
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948155

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3585961
$98.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Matrix Metalloproteinase 2 (MMP2)
NCBI Accession:
NM_004530
Species:
Human
Synonyms:
MMP2, Mmp2, mmp2, LOC657982, LOC100135793
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3922292
$108.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens SPARC-like 1 (hevin), transcript variant 2 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
SPARC-Like 1 (Hevin) (SPARCL1)
NCBI Accession:
NM_004684
Species:
Human
Synonyms:
LOC445896, SPARCL1, sparcl1, Sparcl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591333
$108.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens forkhead box P2 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Forkhead Box P2 (FOXP2)
NCBI Accession:
NM_021804
Species:
Human
Synonyms:
FOXP2, Foxp2, foxp2, foxP2, foxp1c, foxp2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3899405
$151.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens histone deacetylase 10 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Histone Deacetylase 10 (HDAC10)
NCBI Accession:
NM_032019
Species:
Human
Synonyms:
HDAC10, hdac10, hdac10.L, hda10, Hdac10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3905528
$151.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens S100 calcium binding protein A4, transcript variant 1.

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein A4 (S100A4)
NCBI Accession:
NM_002961
Species:
Human
Synonyms:
S100A4, S100A5, S100a4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3579789
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Mus musculus interleukin 7.

Type:
ORF
Application:
Protein Expression
Gene:
Interleukin 7 (IL7)
NCBI Accession:
NM_008371
Species:
Mouse (Murine)
Synonyms:
IL7, Il7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3911589
$65.00
1 vial
Plus shipping costs $45.00
Will be delivered in 11 to 13 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...