Expression-ready ORF Clones

An open reading frame (ORF) is the region of a nucleotide sequence from a start codon to stop codon. In case of eukaryotic ORFs this might also include introns. In practical terms however, an ORF corresponds to the coding sequence (CDS) constituted by concatenated exons that is actually translated to from a protein. Free of any regulatory sequences and with both the 5’ and 3’ UTR removed, our ORF clones provide a shortcut to protein expression or subcloning.
437,352 Products
Data Quality
  • 1
Type
  • 437352
    Plasmid
Gene
  • 997
  • 197
  • 170
  • 161
  • 139
Species
  • 294509
  • 64807
  • 60176
  • 5988
  • 3338
Insert
  • 785880
  • 437352
    ORF
  • 315570
  • 154625
  • 114972
Vector
  • 298383
  • 93526
  • 45442
  • 1
Vector Backbone
  • 54421
  • 42128
  • 41851
  • 33867
  • 30289
Fusion tag
  • 60848
  • 96574
  • 75718
  • 59918
  • 29190
Resistance Gene
  • 229258
  • 89199
  • 83979
  • 34916
Selectable Marker
  • 179802
  • 64160
  • 9547
Promoter
  • 202502
  • 189407
Expression Type
  • 212295
  • 179593
  • 73895
Application
  • 422239
  • 15113
Format
  • 397475
  • 39877
Supplier: Log in to see

Full length Clone DNA of Homo sapiens thioredoxin domain containing 17 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Thioredoxin Domain Containing 17 (TXNDC17)
NCBI Accession:
NM_032731
Species:
Human
Synonyms:
TXNDC17, Txndc17, txndc17
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3568391
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens prothymosin, alpha with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Prothymosin, alpha (PTMA)
NCBI Accession:
NM_001099285
Species:
Human
Synonyms:
PTMA, ptma.L, ptma, Ptma, ptma.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3639841
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens agouti related protein homolog (mouse) (AGRP), transcript variant 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Agouti Related Protein Homolog (Mouse) (AGRP)
NCBI Accession:
NM_001138
Species:
Human
Synonyms:
AGRP, Agrp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615000
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens A kinase (PRKA) anchor protein 7 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
A Kinase (PRKA) Anchor Protein 7 (AKAP7)
Species:
Human
Synonyms:
AKAP7, akap7.L, akap7, Akap7
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3615864
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens acylphosphatase 2, muscle type with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Acylphosphatase 2, Muscle Type (Acyp2)
NCBI Accession:
NM_138448
Species:
Human
Synonyms:
ACYP2, Acyp2, Acyp2-ps1, acyp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3613179
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens SH2 domain protein 1A with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
SH2 Domain Containing 1A (SH2D1A)
NCBI Accession:
NM_002351
Species:
Human
Synonyms:
SH2D1A, Sh2d1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3584949
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens secretoglobin, family 1A, member 1 (uteroglobin) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Secretoglobin, Family 1A, Member 1 (Uteroglobin) (SCGB1A1)
NCBI Accession:
NM_003357
Species:
Human
Synonyms:
SCGB1A1, Scgb1a1, Rup2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3580981
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens serum amyloid A1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Serum Amyloid A1 (SAA1)
NCBI Accession:
NM_000331
Species:
Human
Synonyms:
SAA1, saa, Sden_2438, Mmc1_0571, Riean_0971, Saa1, Saa, SAA3, SAAL1, SAA, LOC476879, LOC694827, SAA2, LOC100009168
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3580070
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens platelet factor 4 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Platelet Factor 4 (PF4)
NCBI Accession:
NM_002619
Species:
Human
Synonyms:
LOC703451, PF4, Pf4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629102
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow).

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
tnnc1.L, tnnc1, TNNC1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605040
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens troponin C type 1 (slow) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cardiac Troponin C (TNNC1)
NCBI Accession:
NM_003280
Species:
Human
Synonyms:
tnnc1.L, tnnc1, TNNC1, Tnnc1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3605041
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4.

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet-Derived Family, Member 4 (REG4)
NCBI Accession:
NM_032044
Species:
Human
Synonyms:
Reg4, REG4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644688
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens regenerating islet-derived family, member 4 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Regenerating Islet-Derived Family, Member 4 (REG4)
NCBI Accession:
NM_032044
Species:
Human
Synonyms:
Reg4, REG4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3644689
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IB (pancreas) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Phospholipase A2 (YWHAZ)
NCBI Accession:
NM_000928
Species:
Human
Synonyms:
CG42237, PLA2, LOC100631065, Pla2, PLA2G1B, Pla2g1b, PLA2G4A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631492
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens peptidylprolyl isomerase A (cyclophilin A).

Type:
ORF
Application:
Protein Expression
Gene:
Peptidylprolyl Isomerase A (Cyclophilin A) (PPIA)
NCBI Accession:
NM_021130
Species:
Human
Synonyms:
PPIA, ppiaa, LOC786614, LOC403581, PPIAP6, LOC473924, ppia.L, Cypa, CNB01230, CNB01290, Tc00.1047053506925.300, Tb11.03.0250, CYPA, Ppia, ppia, LOC788146, LOC100773511
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948152

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3634316
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens peptidylprolyl isomerase A (cyclophilin A) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Peptidylprolyl Isomerase A (Cyclophilin A) (PPIA)
NCBI Accession:
NM_021130
Species:
Human
Synonyms:
PPIA, ppiaa, LOC786614, LOC403581, PPIAP6, LOC473924, ppia.L, Cypa, CNB01230, CNB01290, Tc00.1047053506925.300, Tb11.03.0250, CYPA, Ppia, ppia, LOC788146, LOC100773511
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3634317
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens phospholipase A2, group IIA (platelets, synovial fluid) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
phospholipase A2, Group IIA (Platelets, Synovial Fluid) (PLA2G2A)
NCBI Accession:
NM_000300
Species:
Human
Synonyms:
PLA2G2A, Pla2g2a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3631517
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens prokineticin 1 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Prokineticin 1 (Prok1)
NCBI Accession:
NM_032414
Species:
Human
Synonyms:
PROK1, prok1, Prok1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3637206
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Cyclin-Dependent Kinase Inhibitor 2B (p15, Inhibits CDK4) (CDKN2B)
NCBI Accession:
NM_004936
Species:
Human
Synonyms:
CDKN2B, cdn2b, cdkn2b, cdkn2b.L, Cdkn2b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV2-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3973359
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 10 with Flag tag.

Type:
ORF
Application:
Protein Expression
Gene:
Chemokine (C-X-C Motif) Ligand 10 (CXCL10)
NCBI Accession:
NM_001565
Species:
Human
Synonyms:
CXCL10, cxl10, Cxcl10
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-hygro-FLAG
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948156

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3981002
$65.00
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1
  • ...
  • ...
  • ...
  • ...
  • ...