Abcg3 (ATP-Binding Cassette, Sub-Family G (WHITE), Member 3, Abcg3)

Short Description: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR\\/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins\\\\; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined\\\\; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008].
More information related to gene Abcg3.
Products related to Abcg3 Gene:
9 Products
Type
  • 9
Species
  • 6
  • 3
Application
  • 4
  • 3
  • 2
Fusion tag
  • 4
  • 2
  • 2
  • 1
Vector Backbone
  • 4
  • 2
  • 1
  • 1
  • 1
Vector
  • 4
  • 4
  • 1
Insert
  • 4
  • 3
  • 2
Resistance Gene
  • 6
  • 2
  • 1
Expression Type
  • 5
  • 2
Selectable Marker
  • 4
  • 2
Promoter
  • 3
  • 2
Format
  • 5
  • 3
  • 1
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004957
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004958
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004959
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004960
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3798354

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3798353
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
NCBI Accession:
NM_001128311,NP_001121783
Species:
Rat (Rattus)
Synonyms:
Abcg3
Insert length:
1977 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5392973
$860.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
NCBI Accession:
NM_001128311,NP_001121783
Species:
Rat (Rattus)
Synonyms:
Abcg3
Insert length:
1977 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5392975
$1,050.00
10 μg
Plus shipping costs $45.00
Will be delivered in 41 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
NCBI Accession:
NM_001128311,NP_001121783
Species:
Rat (Rattus)
Synonyms:
Abcg3
Insert length:
1977 bp
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Components:
10 μg of lyophilized plasmid
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5392974
$1,160.00
10 μg
Plus shipping costs $45.00
Will be delivered in 41 Business Days
Supplier: Log in to see

Type:
shRNA
Application:
RNA Interference
Gene:
ATP-Binding Cassette, Sub-Family G (WHITE), Member 3 (Abcg3)
Gene ID:
27405 (Mouse (Murine), Abcg3)
Synonyms:
Abcg3
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3798354

Components:
3 constructs per target plus non-targeting control, each construct delivered in 4 tubes of 25ul
Format:
Viral Particles
Buffer:
High Titer: 1x10^8 TU/mL
Storage:
-80 °C
Catalog No. ABIN3798354
$2,603.00
4 x 100 μL
Plus shipping costs $45.00
Delivery in 21 to 26 Business Days
  • <
  • 1
  • >

Synonyms and alternative names related to Abcg3

  • ATP binding cassette subfamily G member 3 (Abcg3)
  • ATP-binding cassette, subfamily G (WHITE), member 3 (Abcg3)
  • Abcp2
  • Mxr2
  • RGD1565568

Gene-IDs for different species

GENE IDSPECIES
27405 Mus musculus
498327 Rattus norvegicus

Protein level used designations for Abcg3

  • ATP-binding cassette sub-family G member 3
  • ATP-binding cassette, subfamily G, member 3
  • ATP-binding cassette, sub-family G (WHITE), member 3
Other products related to Abcg3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com