ABP (Androgen Binding Protein, ABP)

Short Description: plays a role in extracellular transport of androgens [RGD, Feb 2006].
More information related to gene ABP.
Products related to ABP Gene:
9 Products
Type
  • 9
Species
  • 9
Insert
  • 4
  • 4
  • 1
Vector
  • 4
  • 3
  • 2
Vector Backbone
  • 2
  • 2
  • 2
  • 2
  • 1
Fusion tag
  • 4
  • 3
  • 2
Resistance Gene
  • 5
  • 4
Selectable Marker
  • 2
Promoter
  • 4
  • 3
  • 1
Expression Type
  • 7
Application
  • 6
  • 4
  • 1
Format
  • 4
  • 3
  • 2
Supplier: Log in to see

Full length Mus musculus androgen binding protein alpha cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Androgen Binding Protein (ABP)
Gene ID:
11354 (Mouse (Murine), ABP)
Synonyms:
Scgb1b27, Shbg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3483885
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length Mus musculus androgen binding protein alpha cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Androgen Binding Protein (ABP)
Gene ID:
11354 (Mouse (Murine), ABP)
Synonyms:
Scgb1b27, Shbg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466722
$110.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus androgen binding protein alpha cDNA clone.

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Androgen Binding Protein (ABP)
Gene ID:
11354 (Mouse (Murine), ABP)
Synonyms:
Scgb1b27, Shbg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466721
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Full length, sequence guaranteed Mus musculus androgen binding protein alpha cDNA clone.

Type:
cDNA
Application:
Cloning
Gene:
Androgen Binding Protein (ABP)
Gene ID:
11354 (Mouse (Murine), ABP)
Synonyms:
Scgb1b27, Shbg
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001606
$154.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Lenti ORF clone of Scgb1b27 (Myc-DDK-tagged) - Mouse androgen binding protein alpha (Abpa)

Type:
ORF
Application:
Protein Expression
Gene:
Androgen Binding Protein (ABP)
Species:
Mouse (Murine)
Synonyms:
Scgb1b27, Shbg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Viral particles:
ABIN6432158

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
-20 °C,4 °C
Catalog No. ABIN6511049
$652.63
10 μg
Plus shipping costs $45.00
Delivery in 25 to 30 Business Days
Supplier: Log in to see

Lenti ORF clone of Scgb1b27 (mGFP-tagged) - Mouse androgen binding protein alpha (Abpa)

Type:
ORF
Application:
Protein Expression
Gene:
Androgen Binding Protein (ABP)
Species:
Mouse (Murine)
Synonyms:
Scgb1b27, Shbg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Viral particles:
ABIN6432159

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
-20 °C,4 °C
Catalog No. ABIN6511050
$715.79
10 μg
Plus shipping costs $45.00
Delivery in 25 to 30 Business Days
Supplier: Log in to see

Lenti ORF particles, Scgb1b27 (Myc-DDK-tagged) - Mouse androgen binding protein alpha (Abpa)

Type:
ORF
Application:
Protein Expression
Gene:
Androgen Binding Protein (ABP)
Species:
Mouse (Murine)
Synonyms:
Scgb1b27, Shbg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-Myc-DDK
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Viral particles:
ABIN6432158

Components:
Lentiviral particles with guaranteed titer of >10^7 TU/mL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN6432158
$873.68
200 μL
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 25 to 30 Business Days
Supplier: Log in to see

Lenti ORF particles, Scgb1b27 (GFP-tagged) - Mouse androgen binding protein alpha (Abpa)

Type:
ORF
Application:
Protein Expression
Gene:
Androgen Binding Protein (ABP)
Species:
Mouse (Murine)
Synonyms:
Scgb1b27, Shbg
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-C-mGFP
Resistance Gene:
Chloramphenicol
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Transient

Viral particles:
ABIN6432159

Components:
Lentiviral particles with guaranteed titer of >10^7 TU/mL
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN6432159
$978.95
200 μL
Plus shipping costs $45.00 and $22.60 dry ice
Delivery in 25 to 30 Business Days
Supplier: Log in to see

Knockout Kit for Mouse (Murine) Scgb1b27 via CRISPR.

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases
Gene:
Androgen Binding Protein (ABP)
Species:
Mouse (Murine)
Synonyms:
Scgb1b27, Shbg
Vector type:
Mammalian Expression Vector
Vector backbone:
pCas-Guide
Resistance Gene:
Ampicillin
Promoter:
U6 Promoter, Enhanced CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948178

Sequencing Primer:
  • CF3 (ACGATACAAGGCTGTTAGAGAG)
Components:
  • Scgb1b27 gRNA vector 1 in pCAS-Guide vector.
  • Scgb1b27 gRNA vector 2 in pCAS-Guide vector.
  • Donor vector containing Left and right homologous arms and GFP-Puro functional cassette.
  • Scramble sequence in pCas-Guide vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3226346
$1,200.00
1 kit
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1
  • >

Synonyms and alternative names related to ABP

  • secretoglobin, family 1B, member 27 (Scgb1b27)
  • sex hormone binding globulin (Shbg)
  • Abp
  • Abpa
  • Abpa27
  • Sal-1
  • Tcp

Gene-IDs for different species

GENE IDSPECIES
11354 Mus musculus
24775 Rattus norvegicus

Protein level used designations for ABP

  • androgen binding protein alpha
  • androgen-binding protein
  • major allergen 1-like; lacrimal gland protein
  • salivary androgen-binding alpha subunit
  • ABP
  • SBP
  • Sex hormone binding globulin or androgen-binding protein (other gene product from ABP gene)
  • sex hormone-binding globulin
  • sex steroid-binding protein
  • testis-specific androgen-binding protein
Other products related to ABP such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com