Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BCAR3 cDNA Clone in Mammalian Expression Vector

This is a Breast Cancer Anti-Estrogen Resistance 3 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3316761
Supplier Product No.: sc324095
$748.44
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human BCAR3 cDNA Clone in Mammalian Expression Vector (ABIN3316761)

Gene

BCAR3 (Breast Cancer Anti-Estrogen Resistance 3 (BCAR3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc324095

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BCAR3 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Sun, Cheng, Chen, Lim, Pallen: "Protein tyrosine phosphatase α phosphotyrosyl-789 binds BCAR3 to position Cas for activation at integrin-mediated focal adhesions." in: Molecular and cellular biology, Vol. 32, Issue 18, pp. 3776-89, (2012) (PubMed).

    Schrecengost, Riggins, Thomas, Guerrero, Bouton: "Breast cancer antiestrogen resistance-3 expression regulates breast cancer cell migration through promotion of p130Cas membrane localization and membrane ruffling." in: Cancer research, Vol. 67, Issue 13, pp. 6174-82, (2007) (PubMed).

  • Target

    BCAR3 (Breast Cancer Anti-Estrogen Resistance 3 (BCAR3))

    Alternative Name

    BCAR3

    Background

    Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012].Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein (isoform 1).

    NCBI Accession

    NM_003567, NP_003558
You are here: