Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human GPX4 cDNA Clone in Mammalian Expression Vector

This is a Glutathione Peroxidase 4 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3316881
Supplier Product No.: sc324086
$457.38
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human GPX4 cDNA Clone in Mammalian Expression Vector (ABIN3316881)

Gene

GPX4 (Glutathione Peroxidase 4 (GPX4))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc324086

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human GPX4 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Agbor, Demma, Mrsny, Castillo, Boll, McCormick: "The oxido-reductase enzyme glutathione peroxidase 4 (GPX4) governs Salmonella Typhimurium-induced neutrophil transepithelial migration." in: Cellular microbiology, Vol. 16, Issue 9, pp. 1339-53, (2014) (PubMed).

  • Target

    GPX4 (Glutathione Peroxidase 4 (GPX4))

    Alternative Name

    GPX4

    Background

    This gene encodes a member of the glutathione peroxidase protein family. Glutathione peroxidase catalyzes the reduction of hydrogen peroxide, organic hydroperoxide, and lipid peroxides by reduced glutathione and functions in the protection of cells against oxidative damage. Human plasma glutathione peroxidase has been shown to be a selenium-containing enzyme and the UGA codon is translated into a selenocysteine. The encoded protein has been identified as a moonlighting protein based on its ability to serve dual functions as a peroxidase as well as a structural protein in mature spermatozoa. Through alternative splicing and transcription initiation, rat produces proteins that localize to the nucleus, mitochondrion, and cytoplasm. In humans, alternative transcription initiation and the cleavage sites of the mitochondrial and nuclear transit peptides need to be experimentally verified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014].Transcript Variant: This variant (1) represents the shortest transcript and encodes the shortest isoform (A). A similar transcript in rat generates long and short forms of the encoded protein through alternative transcription initiation sites, the long form contains a mitochondrial transit peptide and localizes to the mitochondrion. The rat short form lacks a mitochondrial transit peptide and is present in the cytoplasm.

    NCBI Accession

    NM_002085, NP_002076
You are here: