Human GPX4 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human GPX4 cDNA Clone in Mammalian Expression Vector (ABIN3316881)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc324086
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human GPX4 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: ECoRI-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The oxido-reductase enzyme glutathione peroxidase 4 (GPX4) governs Salmonella Typhimurium-induced neutrophil transepithelial migration." in: Cellular microbiology, Vol. 16, Issue 9, pp. 1339-53, (2014) (PubMed).
-
-
- GPX4 (Glutathione Peroxidase 4 (GPX4))
-
Alternative Name
- GPX4
-
Background
- This gene encodes a member of the glutathione peroxidase protein family. Glutathione peroxidase catalyzes the reduction of hydrogen peroxide, organic hydroperoxide, and lipid peroxides by reduced glutathione and functions in the protection of cells against oxidative damage. Human plasma glutathione peroxidase has been shown to be a selenium-containing enzyme and the UGA codon is translated into a selenocysteine. The encoded protein has been identified as a moonlighting protein based on its ability to serve dual functions as a peroxidase as well as a structural protein in mature spermatozoa. Through alternative splicing and transcription initiation, rat produces proteins that localize to the nucleus, mitochondrion, and cytoplasm. In humans, alternative transcription initiation and the cleavage sites of the mitochondrial and nuclear transit peptides need to be experimentally verified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014].Transcript Variant: This variant (1) represents the shortest transcript and encodes the shortest isoform (A). A similar transcript in rat generates long and short forms of the encoded protein through alternative transcription initiation sites, the long form contains a mitochondrial transit peptide and localizes to the mitochondrion. The rat short form lacks a mitochondrial transit peptide and is present in the cytoplasm.
-
NCBI Accession
- NM_002085, NP_002076
Target
-