Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PTRH2 cDNA Clone in Mammalian Expression Vector

This is a Peptidyl-tRNA Hydrolase 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3317035
Supplier Product No.: sc323788
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PTRH2 cDNA Clone in Mammalian Expression Vector (ABIN3317035)

Gene

PTRH2 (Peptidyl-tRNA Hydrolase 2 (PTRH2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc323788

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PTRH2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: ECoRI-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PTRH2 (Peptidyl-tRNA Hydrolase 2 (PTRH2))

    Alternative Name

    PTRH2

    Background

    The protein encoded by this gene is a mitochondrial protein with two putative domains, an N-terminal mitochondrial localization sequence, and a UPF0099 domain. In vitro assays suggest that this protein possesses peptidyl-tRNA hydrolase activity, to release the peptidyl moiety from tRNA, thereby preventing the accumulation of dissociated peptidyl-tRNA that could reduce the efficiency of translation. This protein also plays a role regulating cell survival and death. It promotes survival as part of an integrin-signaling pathway for cells attached to the extracellular matrix (ECM), but also promotes apoptosis in cells that have lost their attachment to the ECM, a process called anoikos. After loss of cell attachment to the ECM, this protein is phosphorylated, is released from the mitochondria into the cytosol, and promotes caspase-independent apoptosis through interactions with transcriptional regulators. This gene has been implicated in the development and progression of tumors, and mutations in this gene have been associated with an infantile multisystem neurologic, endocrine, and pancreatic disease (INMEPD) characterized by intellectual disability, postnatal microcephaly, progressive cerebellar atrophy, hearing impairment, polyneuropathy, failure to thrive, and organ fibrosis with exocrine pancreas insufficiency (PMID: 25574476). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015].Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform b which is one amino acid shorter at the N-terminus compared to isoform a.

    NCBI Accession

    NM_016077, NP_057161
You are here: