Human AKR1C3 cDNA Clone in Mammalian Expression Vector
This is a Aldo-Keto Reductase Family 1, Member C3 (3-alpha Hydroxysteroid Dehydrogenase, Type II) plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3317222
Supplier Product No.: sc321532
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human AKR1C3 cDNA Clone in Mammalian Expression Vector (ABIN3317222)
Gene
AKR1C3
(Aldo-Keto Reductase Family 1, Member C3 (3-alpha Hydroxysteroid Dehydrogenase, Type II) (AKR1C3))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc321532
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human AKR1C3 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Elevated expression of AKR1C3 increases resistance of cancer cells to ionizing radiation via modulation of oxidative stress." in: PLoS ONE, Vol. 9, Issue 11, pp. e111911, (2014) (PubMed).
-
: "Elevated expression of AKR1C3 increases resistance of cancer cells to ionizing radiation via modulation of oxidative stress." in: PLoS ONE, Vol. 9, Issue 11, pp. e111911, (2014) (PubMed).
-
- AKR1C3 (Aldo-Keto Reductase Family 1, Member C3 (3-alpha Hydroxysteroid Dehydrogenase, Type II) (AKR1C3))
-
Alternative Name
- AKR1C3
-
Background
- This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011].Transcript Variant: This variant (1) represents the longest transcript and encodes one of the larger isoforms (1).
-
NCBI Accession
- NM_003739, NP_003730
Target
-
You are here:
