Human ALDH1A1 cDNA Clone in Mammalian Expression Vector
This is a Aldehyde Dehydrogenase 1 Family, Member A1 plasmid from OriGene - 5 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(5 references)
Catalog No. ABIN3317224
Supplier Product No.: sc321535
$462.33
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human ALDH1A1 cDNA Clone in Mammalian Expression Vector (ABIN3317224)
Gene
ALDH1A1
(Aldehyde Dehydrogenase 1 Family, Member A1 (ALDH1A1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc321535
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ALDH1A1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations." in: Journal of lipid research, Vol. 56, Issue 2, pp. 342-57, (2015) (PubMed).
: "Aldehyde dehydrogenase-1a1 induces oncogene suppressor genes in B cell populations." in: Biochimica et biophysica acta, Vol. 1833, Issue 12, pp. 3218-27, (2013) (PubMed).
: "Studying fatty aldehyde metabolism in living cells with pyrene-labeled compounds." in: Journal of lipid research, Vol. 53, Issue 7, pp. 1410-6, (2012) (PubMed).
: "Aldehyde dehydrogenase 1A1--a new mediator of resistance to temozolomide in glioblastoma." in: Neuro-oncology, Vol. 14, Issue 12, pp. 1452-64, (2012) (PubMed).
: "Concerted action of aldehyde dehydrogenases influences depot-specific fat formation." in: Molecular endocrinology (Baltimore, Md.), Vol. 25, Issue 5, pp. 799-809, (2011) (PubMed).
-
: "Importance of ALDH1A enzymes in determining human testicular retinoic acid concentrations." in: Journal of lipid research, Vol. 56, Issue 2, pp. 342-57, (2015) (PubMed).
-
- ALDH1A1 (Aldehyde Dehydrogenase 1 Family, Member A1 (ALDH1A1))
-
Alternative Name
- ALDH1A1
-
Background
- The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011].
-
NCBI Accession
- NM_000689, NP_000680
Target
-
You are here:
