Human APOE cDNA Clone in Mammalian Expression Vector
This is a Apolipoprotein E plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(3 references)
Catalog No. ABIN3317255
Supplier Product No.: sc319433
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 8 Business Days
Quick Overview for Human APOE cDNA Clone in Mammalian Expression Vector (ABIN3317255)
Gene
APOE
(Apolipoprotein E (APOE))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc319433
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human APOE is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Influence of the APOE genotype on hepatic stress response: Studies in APOE targeted replacement mice and human liver cells." in: Free radical biology & medicine, Vol. 96, pp. 264-72, (2016) (PubMed).
: "The C-terminal alpha-helix domain of apolipoprotein E is required for interaction with nonstructural protein 5A and assembly of hepatitis C virus." in: Journal of virology, Vol. 84, Issue 21, pp. 11532-41, (2010) (PubMed).
: "Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture." in: Journal of virology, Vol. 81, Issue 24, pp. 13783-93, (2007) (PubMed).
-
: "Influence of the APOE genotype on hepatic stress response: Studies in APOE targeted replacement mice and human liver cells." in: Free radical biology & medicine, Vol. 96, pp. 264-72, (2016) (PubMed).
-
- APOE (Apolipoprotein E (APOE))
-
Alternative Name
- APOE
-
Background
- The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b.
-
NCBI Accession
- NM_000041, NP_000032
Target
-
You are here:
