Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human APOE cDNA Clone in Mammalian Expression Vector

This is a Apolipoprotein E plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3317255
Supplier Product No.: sc319433
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 8 Business Days

Quick Overview for Human APOE cDNA Clone in Mammalian Expression Vector (ABIN3317255)

Gene

APOE (Apolipoprotein E (APOE))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc319433

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human APOE is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Dose, Nebel, Piegholdt, Rimbach, Huebbe: "Influence of the APOE genotype on hepatic stress response: Studies in APOE targeted replacement mice and human liver cells." in: Free radical biology & medicine, Vol. 96, pp. 264-72, (2016) (PubMed).

    Cun, Jiang, Luo: "The C-terminal alpha-helix domain of apolipoprotein E is required for interaction with nonstructural protein 5A and assembly of hepatitis C virus." in: Journal of virology, Vol. 84, Issue 21, pp. 11532-41, (2010) (PubMed).

    Chang, Jiang, Cai, Luo: "Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture." in: Journal of virology, Vol. 81, Issue 24, pp. 13783-93, (2007) (PubMed).

  • Target

    APOE (Apolipoprotein E (APOE))

    Alternative Name

    APOE

    Background

    The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014].Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b.

    NCBI Accession

    NM_000041, NP_000032
You are here: