Human AXIN1 cDNA Clone in Mammalian Expression Vector
This is a Axin 1 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3317282
Supplier Product No.: sc319963
$749.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human AXIN1 cDNA Clone in Mammalian Expression Vector (ABIN3317282)
Gene
Axin (AXIN1)
(Axin 1 (AXIN1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc319963
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human AXIN1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Identification and characterization of a small-molecule inhibitor of Wnt signaling in glioblastoma cells. ..." in: Molecular cancer therapeutics, Vol. 12, Issue 7, pp. 1180-9, (2013) (PubMed).
-
: "Identification and characterization of a small-molecule inhibitor of Wnt signaling in glioblastoma cells. ..." in: Molecular cancer therapeutics, Vol. 12, Issue 7, pp. 1180-9, (2013) (PubMed).
-
- Axin (AXIN1) (Axin 1 (AXIN1))
-
Alternative Name
- AXIN1
-
Background
- This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016].Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1. The resulting protein (isoform b) is shorter, compared to isoform a. An upstream in-frame AUG is present that could extend the N-terminus of this isoform by 49 aa, however, there is no evidence that the upstream AUG is used, so the shorter N-terminus is being annotated.
-
NCBI Accession
- NM_181050, NP_851393
Target
-
You are here:
