Human CEBPB cDNA Clone in Mammalian Expression Vector
This is a CCAAT/enhancer Binding Protein (C/EBP), beta plasmid from OriGene - 8 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(8 references)
Catalog No. ABIN3317379
Supplier Product No.: sc319561
$452.43
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human CEBPB cDNA Clone in Mammalian Expression Vector (ABIN3317379)
Gene
CEBPB
(CCAAT/enhancer Binding Protein (C/EBP), beta (CEBPB))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc319561
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human CEBPB is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Derivate isocorydine inhibits cell proliferation in hepatocellular carcinoma cell lines by inducing G2/M cell cycle arrest and apoptosis." in: Tumour biology, Vol. 37, Issue 5, pp. 5951-61, (2016) (PubMed).
: "Intestinal neuroendocrine cells and goblet cells are mediators of IL-17A-amplified epithelial IL-17C production in human inflammatory bowel disease." in: Mucosal immunology, Vol. 8, Issue 4, pp. 943-58, (2015) (PubMed).
: "ATF4 Gene Network Mediates Cellular Response to the Anticancer PAD Inhibitor YW3-56 in Triple-Negative Breast Cancer Cells." in: Molecular cancer therapeutics, Vol. 14, Issue 4, pp. 877-88, (2015) (PubMed).
: "Tumor cell-secreted angiogenin induces angiogenic activity of endothelial cells by suppressing miR-542-3p." in: Cancer letters, Vol. 368, Issue 1, pp. 115-25, (2015) (PubMed).
: "C/EBP transcription factors in human squamous cell carcinoma: selective changes in expression of isoforms correlate with the neoplastic state." in: PLoS ONE, Vol. 9, Issue 11, pp. e112073, (2014) (PubMed).
: "The CCAAT/enhancer-binding protein beta-2 isoform (CEBPβ-2) upregulates galectin-7 expression in human breast cancer cells." in: PLoS ONE, Vol. 9, Issue 5, pp. e95087, (2014) (PubMed).
: "Herpes simplex virus type 2 infection of human epithelial cells induces CXCL9 expression and CD4+ T cell migration via activation of p38-CCAAT/enhancer-binding protein-β pathway." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 188, Issue 12, pp. 6247-57, (2012) (PubMed).
: "C/EBP-beta modulates transcription of tubulointerstitial nephritis antigen in obstructive uropathy." in: Journal of the American Society of Nephrology : JASN, Vol. 20, Issue 4, pp. 807-19, (2009) (PubMed).
-
-
- CEBPB (CCAAT/enhancer Binding Protein (C/EBP), beta (CEBPB))
-
Alternative Name
- CEBPB
-
Background
- This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013].Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (a, also known as LAP*) represented in this RefSeq results from translation initiation at the 5' most AUG start codon and is the longest isoform.
-
NCBI Accession
- NM_005194, NP_005185
Target
-
You are here:
