Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CRYbA2 cDNA Clone in Mammalian Expression Vector

This is a Crystallin, beta A2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3317436
Supplier Product No.: sc320739
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CRYbA2 cDNA Clone in Mammalian Expression Vector (ABIN3317436)

Gene

CRYbA2 (Crystallin, beta A2 (CRYbA2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc320739

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CRYBA2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    CRYbA2 (Crystallin, beta A2 (CRYbA2))

    Alternative Name

    CRYBA2

    Background

    Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families, beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (3) contains a different 5' UTR region when compared to variant 1, and lacks an internal 5' UTR region when compared to variant 2. It encodes a protein identical to that encoded by variants 2 and 3.

    NCBI Accession

    NM_057094, NP_476435
You are here: