Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human IDH2 cDNA Clone in Mammalian Expression Vector

This is a Isocitrate Dehydrogenase 2 (NADP+), Mitochondrial plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3317730
Supplier Product No.: sc319226
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human IDH2 cDNA Clone in Mammalian Expression Vector (ABIN3317730)

Gene

IDH2 (Isocitrate Dehydrogenase 2 (NADP+), Mitochondrial (IDH2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc319226

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human IDH2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Akbay, Moslehi, Christensen, Saha, Tchaicha, Ramkissoon, Stewart, Carretero, Kikuchi, Zhang, Cohoon, Murray, Liu, Uno, Fisch, Jones, Gurumurthy, Gliser, Choe, Keenan, Son, Stanley, Losman, Padera et al.: "D-2-hydroxyglutarate produced by mutant IDH2 causes cardiomyopathy and neurodegeneration in mice. ..." in: Genes & development, Vol. 28, Issue 5, pp. 479-90, (2014) (PubMed).

    Gross, Cairns, Minden, Driggers, Bittinger, Jang, Sasaki, Jin, Schenkein, Su, Dang, Fantin, Mak: "Cancer-associated metabolite 2-hydroxyglutarate accumulates in acute myelogenous leukemia with isocitrate dehydrogenase 1 and 2 mutations." in: The Journal of experimental medicine, Vol. 207, Issue 2, pp. 339-44, (2010) (PubMed).

    Yan, Parsons, Jin, McLendon, Rasheed, Yuan, Kos, Batinic-Haberle, Jones, Riggins, Friedman, Friedman, Reardon, Herndon, Kinzler, Velculescu, Vogelstein, Bigner: "IDH1 and IDH2 mutations in gliomas." in: The New England journal of medicine, Vol. 360, Issue 8, pp. 765-73, (2009) (PubMed).

  • Target

    IDH2 (Isocitrate Dehydrogenase 2 (NADP+), Mitochondrial (IDH2))

    Alternative Name

    IDH2

    Background

    Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

    NCBI Accession

    NM_002168, NP_002159
You are here: