Human MMP2 cDNA Clone in Mammalian Expression Vector
This is a Matrix Metalloproteinase 2 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(2 references)
Catalog No. ABIN3317862
Supplier Product No.: sc321560
$913.77
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human MMP2 cDNA Clone in Mammalian Expression Vector (ABIN3317862)
Gene
MMP2
(Matrix Metalloproteinase 2 (MMP2))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc321560
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human MMP2 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Nanolitre liquid patterning in aqueous environments for spatially defined reagent delivery to mammalian cells." in: Nature materials, Vol. 8, Issue 9, pp. 736-41, (2009) (PubMed).
: "Identification of amino acid residues of matrix metalloproteinase-7 essential for binding to cholesterol sulfate." in: The Journal of biological chemistry, Vol. 283, Issue 51, pp. 35735-44, (2008) (PubMed).
-
: "Nanolitre liquid patterning in aqueous environments for spatially defined reagent delivery to mammalian cells." in: Nature materials, Vol. 8, Issue 9, pp. 736-41, (2009) (PubMed).
-
- MMP2 (Matrix Metalloproteinase 2 (MMP2))
-
Alternative Name
- MMP2
-
Background
- This gene is a member of the matrix metalloproteinase (MMP) gene family, that are zinc-dependent enzymes capable of cleaving components of the extracellular matrix and molecules involved in signal transduction. The protein encoded by this gene is a gelatinase A, type IV collagenase, that contains three fibronectin type II repeats in its catalytic site that allow binding of denatured type IV and V collagen and elastin. Unlike most MMP family members, activation of this protein can occur on the cell membrane. This enzyme can be activated extracellularly by proteases, or, intracellulary by its S-glutathiolation with no requirement for proteolytical removal of the pro-domain. This protein is thought to be involved in multiple pathways including roles in the nervous system, endometrial menstrual breakdown, regulation of vascularization, and metastasis. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014].Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
-
NCBI Accession
- NM_004530, NP_004521
Target
-
You are here:
