Human ORAI1 cDNA Clone in Mammalian Expression Vector
This is a ORAI Calcium Release-Activated Calcium Modulator 1 plasmid from OriGene - 7 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(7 references)
Catalog No. ABIN3317987
Supplier Product No.: sc321019
$445.50
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ORAI1 cDNA Clone in Mammalian Expression Vector (ABIN3317987)
Gene
ORAI1
(ORAI Calcium Release-Activated Calcium Modulator 1 (ORAI1))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc321019
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ORAI1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Rai1 haploinsufficiency causes reduced Bdnf expression resulting in hyperphagia, obesity and altered fat distribution in mice and humans with no evidence of metabolic syndrome." in: Human molecular genetics, Vol. 19, Issue 20, pp. 4026-42, (2010) (PubMed).
: "TRPC channels function independently of STIM1 and Orai1." in: The Journal of physiology, Vol. 587, Issue Pt 10, pp. 2275-98, (2009) (PubMed).
: "Canonical transient receptor potential 5 channel in conjunction with Orai1 and STIM1 allows Sr2+ entry, optimal influx of Ca2+, and degranulation in a rat mast cell line." in: Journal of immunology (Baltimore, Md. : 1950), Vol. 180, Issue 4, pp. 2233-9, (2008) (PubMed).
: "Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3." in: The Journal of biological chemistry, Vol. 283, Issue 25, pp. 17662-71, (2008) (PubMed).
: "Orai proteins interact with TRPC channels and confer responsiveness to store depletion." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 104, Issue 11, pp. 4682-7, (2007) (PubMed).
: "Orai1 and STIM reconstitute store-operated calcium channel function." in: The Journal of biological chemistry, Vol. 281, Issue 30, pp. 20661-5, (2006) (PubMed).
: "Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1." in: The Journal of biological chemistry, Vol. 281, Issue 34, pp. 24979-90, (2006) (PubMed).
-
: "Rai1 haploinsufficiency causes reduced Bdnf expression resulting in hyperphagia, obesity and altered fat distribution in mice and humans with no evidence of metabolic syndrome." in: Human molecular genetics, Vol. 19, Issue 20, pp. 4026-42, (2010) (PubMed).
-
- ORAI1 (ORAI Calcium Release-Activated Calcium Modulator 1 (ORAI1))
-
Alternative Name
- ORAI1
-
Background
- The protein encoded by this gene is a membrane calcium channel subunit that is activated by the calcium sensor STIM1 when calcium stores are depleted. This type of channel is the primary way for calcium influx into T-cells. Defects in this gene are a cause of immune dysfunction with T-cell inactivation due to calcium entry defect type 1 (IDTICED1). [provided by RefSeq, Sep 2011].
-
NCBI Accession
- NM_032790, NP_116179
Target
-
You are here:
