Human ZNF278 cDNA Clone in Mammalian Expression Vector
This is a Zinc Finger Protein 278 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(1 reference)
Catalog No. ABIN3318001
Supplier Product No.: sc319573
$495.99
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human ZNF278 cDNA Clone in Mammalian Expression Vector (ABIN3318001)
Gene
PATZ1 (ZNF278)
(Zinc Finger Protein 278 (ZNF278))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc319573
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PATZ1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Transcription factors with conserved binding sites near ATOH1 on the POU4F3 gene enhance the induction of cochlear hair cells." in: Molecular neurobiology, Vol. 51, Issue 2, pp. 672-84, (2015) (PubMed).
-
-
- PATZ1 (ZNF278) (Zinc Finger Protein 278 (ZNF278))
-
Alternative Name
- PATZ1
-
Background
- The protein encoded by this gene contains an A-T hook DNA binding motif which usually binds to other DNA binding structures to play an important role in chromatin modeling and transcription regulation. Its Poz domain is thought to function as a site for protein-protein interaction and is required for transcriptional repression, and the zinc-fingers comprise the DNA binding domain. Since the encoded protein has typical features of a transcription factor, it is postulated to be a repressor of gene expression. In small round cell sarcoma, this gene is fused to EWS by a small inversion of 22q, then the hybrid is thought to be translocated (t(1,22)(p36.1,q12). The rearrangement of chromosome 22 involves intron 8 of EWS and exon 1 of this gene creating a chimeric sequence containing the transactivation domain of EWS fused to zinc finger domain of this protein. This is a distinct example of an intra-chromosomal rearrangement of chromosome 22. Four alternatively spliced transcript variants are described for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (4) differs in the 3' UTR and has multiple coding region differences (compared to variant 1), one of which results in a frameshift. This results in a shorter protein (short isoform) with a distinct C-terminus, compared to the long C isoform. This short isoform interacts with RING finger protein 4 through its A-T hook DNA binding domain. It acts as a transcriptional repressor, whereas its partner RING finger protein 4 behaves as a transcriptional activator. Thus the association of this isoform with RING finger protein 4 seems to switch activation to repression.
-
NCBI Accession
- NM_032051, NP_114440
Target
-
You are here:
