Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PCBP2 cDNA Clone in Mammalian Expression Vector

This is a Poly(rC) Binding Protein 2 plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318004
Supplier Product No.: sc319398
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PCBP2 cDNA Clone in Mammalian Expression Vector (ABIN3318004)

Gene

PCBP2 (Poly(rC) Binding Protein 2 (PCBP2))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc319398

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PCBP2 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    PCBP2 (Poly(rC) Binding Protein 2 (PCBP2))

    Alternative Name

    PCBP2

    Background

    The protein encoded by this gene appears to be multifunctional. Along with PCBP-1 and hnRNPK, it is one of the major cellular poly(rC)-binding proteins. The encoded protein contains three K-homologous (KH) domains which may be involved in RNA binding. Together with PCBP-1, this protein also functions as a translational coactivator of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES, promoting poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. This multiexon structural mRNA is thought to be retrotransposed to generate PCBP-1, an intronless gene with functions similar to that of PCBP2. This gene and PCBP-1 have paralogous genes (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. Thsi gene also has two processed pseudogenes (PCBP2P1 and PCBP2P2). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

    NCBI Accession

    NM_031989, NP_114366
You are here: