Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PLAUR cDNA Clone in Mammalian Expression Vector

This is a Plasminogen Activator, Urokinase Receptor plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318045
Supplier Product No.: sc319092
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PLAUR cDNA Clone in Mammalian Expression Vector (ABIN3318045)

Gene

PLAUR (Plasminogen Activator, Urokinase Receptor (PLAUR))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc319092

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PLAUR is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Alapati, Kesanakurti, Rao, Dasari: "uPAR and cathepsin B-mediated compartmentalization of JNK regulates the migration of glioma-initiating cells." in: Stem cell research, Vol. 12, Issue 3, pp. 716-29, (2014) (PubMed).

    Asuthkar, Gondi, Nalla, Velpula, Gorantla, Rao: "Urokinase-type plasminogen activator receptor (uPAR)-mediated regulation of WNT/β-catenin signaling is enhanced in irradiated medulloblastoma cells." in: The Journal of biological chemistry, Vol. 287, Issue 24, pp. 20576-89, (2012) (PubMed).

    Ghosh, Koblinski, Johnson, Liu, Ericsson, Davis, Shi, Ravosa, Crawford, Frazier, Stack: "Urinary-type plasminogen activator receptor/alpha 3 beta 1 integrin signaling, altered gene expression, and oral tumor progression." in: Molecular cancer research : MCR, Vol. 8, Issue 2, pp. 145-58, (2010) (PubMed).

  • Target

    PLAUR (Plasminogen Activator, Urokinase Receptor (PLAUR))

    Alternative Name

    PLAUR

    Background

    This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) encodes the longest isoform (1) which contains three LU (Ly-6 antigen/uPA receptor-like) domains.

    NCBI Accession

    NM_002659, NP_002650
You are here: