Human RNASEH1 cDNA Clone in Mammalian Expression Vector
This is a Ribonuclease H1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(4 references)
Catalog No. ABIN3318172
Supplier Product No.: sc319446
$297.00
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human RNASEH1 cDNA Clone in Mammalian Expression Vector (ABIN3318172)
Gene
Ribonuclease H1 (RNASEH1)
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc319446
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human RNASEH1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: EcoRI-XhoI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "The core spliceosome as target and effector of non-canonical ATM signalling." in: Nature, Vol. 523, Issue 7558, pp. 53-8, (2015) (PubMed).
: "RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells." in: Nature communications, Vol. 5, pp. 5220, (2014) (PubMed).
: "Increased replication initiation and conflicts with transcription underlie Cyclin E-induced replication stress." in: Oncogene, Vol. 32, Issue 32, pp. 3744-53, (2013) (PubMed).
: "Topoisomerase I suppresses genomic instability by preventing interference between replication and transcription." in: Nature cell biology, Vol. 11, Issue 11, pp. 1315-24, (2009) (PubMed).
-
: "The core spliceosome as target and effector of non-canonical ATM signalling." in: Nature, Vol. 523, Issue 7558, pp. 53-8, (2015) (PubMed).
-
- Ribonuclease H1 (RNASEH1)
-
Alternative Name
- RNASEH1
-
Background
- This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and is necessary for DNA replication and repair. This enzyme is present in both mitochondria and nuclei, which are resulted from translation of a single mRNA with two in-frame initiation start codons. The use of the first start codon produces the mitochondrial isoform and the use of the second start codon produces the nuclear isoform. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF) which overlaps the first initiation start codon in human. An alternately spliced transcript variant has been found which encodes a shorter isoform. This gene has three pseudogenes, two of them are at different locations of chromosome 17 and one of them is on chromosome 1q32.2. [provided by RefSeq, Sep 2014].Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the longer isoform (1), which is a mitochondrial protein (see details in PMID: 20823270).
-
NCBI Accession
- NM_002936, NP_002927
Target
-
You are here:
