Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human SLC2A9 cDNA Clone in Mammalian Expression Vector

This is a Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 9 plasmid from OriGene - 3 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 1900 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318273
Supplier Product No.: sc319239
$472.23
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human SLC2A9 cDNA Clone in Mammalian Expression Vector (ABIN3318273)

Gene

SLC2A9 (Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 9 (SLC2A9))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc319239

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human SLC2A9 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: EcoRI-XhoI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1900 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Kimura, Takahashi, Yan, Sakurai: "Expression of SLC2A9 isoforms in the kidney and their localization in polarized epithelial cells." in: PLoS ONE, Vol. 9, Issue 1, pp. e84996, (2014) (PubMed).

    Clémençon, Lüscher, Fine, Baumann, Surbek, Bonny, Hediger: "Expression, purification, and structural insights for the human uric acid transporter, GLUT9, using the Xenopus laevis oocytes system." in: PLoS ONE, Vol. 9, Issue 10, pp. e108852, (2014) (PubMed).

    Anzai, Ichida, Jutabha, Kimura, Babu, Jin, Srivastava, Kitamura, Hisatome, Endou, Sakurai: "Plasma urate level is directly regulated by a voltage-driven urate efflux transporter URATv1 (SLC2A9) in humans." in: The Journal of biological chemistry, Vol. 283, Issue 40, pp. 26834-8, (2008) (PubMed).

  • Target

    SLC2A9 (Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 9 (SLC2A9))

    Alternative Name

    SLC2A9

    Background

    This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2), also known as GLUT9deltaN, contains alternate in-frame segments in the 5' UTR and coding region and uses a different start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1.

    NCBI Accession

    NM_001001290, NP_001001290
You are here: