Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CHRFAM7A cDNA Clone in Mammalian Expression Vector

This is a CHRNA7 (Cholinergic Receptor, Nicotinic, alpha 7, Exons 5-10) and FAM7A (Family with Sequence Similarity 7A, Exons A-E) Fusion plasmid from OriGene with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318761
Supplier Product No.: sc321716
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CHRFAM7A cDNA Clone in Mammalian Expression Vector (ABIN3318761)

Gene

CHRFAM7A (CHRNA7 (Cholinergic Receptor, Nicotinic, alpha 7, Exons 5-10) and FAM7A (Family with Sequence Similarity 7A, Exons A-E) Fusion (CHRFAM7A))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321716

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CHRFAM7A is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: RsrII-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Target

    CHRFAM7A (CHRNA7 (Cholinergic Receptor, Nicotinic, alpha 7, Exons 5-10) and FAM7A (Family with Sequence Similarity 7A, Exons A-E) Fusion (CHRFAM7A))

    Alternative Name

    CHRFAM7A

    Background

    The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The family member CHRNA7, which is located on chromosome 15 in a region associated with several neuropsychiatric disorders, is partially duplicated and forms a hybrid with a novel gene from the family with sequence similarity 7 (FAM7A). Alternative splicing has been observed, and two variants exist, for this hybrid gene. The N-terminally truncated products predicted by the largest open reading frames for each variant would lack the majority of the neurotransmitter-gated ion-channel ligand binding domain but retain the transmembrane region that forms the ion channel. Although current evidence supports transcription of this hybrid gene, translation of the nicotinic acetylcholine receptor-like protein-encoding open reading frames has not been confirmed. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) lacks an internal exon compared to variant 1, and is missing the translation initiation site used by the longer variant. Translation from variant 2 initiates at a downstream site relative to variant 1, resulting in isoform (2), which is truncated at the N-terminus compared to isoform 1.

    NCBI Accession

    NM_148911, NP_683709
You are here: