Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human CYGB cDNA Clone in Mammalian Expression Vector

This is a Cytoglobin plasmid from OriGene - 6 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318801
Supplier Product No.: sc321813
$297.00
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human CYGB cDNA Clone in Mammalian Expression Vector (ABIN3318801)

Gene

CYGB (Cytoglobin (CYGB))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321813

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human CYGB is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: RsrII-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Tejero, Kapralov, Baumgartner, Sparacino-Watkins, Anthonymutu, Vlasova, Camacho, Gladwin, Bayir, Kagan: "Peroxidase activation of cytoglobin by anionic phospholipids: Mechanisms and consequences." in: Biochimica et biophysica acta, Vol. 1861, Issue 5, pp. 391-401, (2016) (PubMed).

    Beckerson, Wilson, Svistunenko, Reeder: "Cytoglobin ligand binding regulated by changing haem-co-ordination in response to intramolecular disulfide bond formation and lipid interaction." in: The Biochemical journal, Vol. 465, Issue 1, pp. 127-37, (2015) (PubMed).

    Beckerson, Svistunenko, Reeder: "Effect of the distal histidine on the peroxidatic activity of monomeric cytoglobin." in: F1000Research, Vol. 4, pp. 87, (2015) (PubMed).

    Chen, Zhao, Meng: "Expression and biological role of cytoglobin in human ovarian cancer." in: Tumour biology, Vol. 35, Issue 7, pp. 6933-9, (2014) (PubMed).

    John, Chand, Chakraborty, Jaiswal, Nag: "DNA damage induced activation of Cygb stabilizes p53 and mediates G1 arrest." in: DNA repair, Vol. 24, pp. 107-12, (2014) (PubMed).

    Oleksiewicz, Liloglou, Tasopoulou, Daskoulidou, Bryan, Gosney, Field, Xinarianos: "Cytoglobin has bimodal: tumour suppressor and oncogene functions in lung cancer cell lines." in: Human molecular genetics, Vol. 22, Issue 16, pp. 3207-17, (2013) (PubMed).

  • Target

    CYGB (Cytoglobin (CYGB))

    Alternative Name

    CYGB

    Background

    This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation. [provided by RefSeq, Jan 2012].

    NCBI Accession

    NM_134268, NP_599030
You are here: