Human DEFA1B cDNA Clone in Mammalian Expression Vector
Quick Overview for Human DEFA1B cDNA Clone in Mammalian Expression Vector (ABIN3318816)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc321787
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human DEFA1B is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: RsrII-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human DEFA1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human DEFA1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human DEFA1B cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human DEFA1B cDNA Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)cDNA PExp Mammalian Expression Vector pCMV6-Entry Kanamycin Enhanced CMV Promoter unconjugated Transient
![Human DEFA1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human DEFA1B ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human DEFA1B ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human DEFA1B ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human DEFA1B shRNA in Retroviral Vector (GFP tag)]()
Human DEFA1B shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- DEFA1B (Defensin, alpha 1B (DEFA1B))
-
Alternative Name
- DEFA1B
-
Background
- Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014].Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and initiates translation at a downstream start site compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
-
NCBI Accession
- NM_001042500, NP_001035965
Target
-
