Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human FAS cDNA Clone in Mammalian Expression Vector

This is a TNF Receptor Superfamily, Member 6 plasmid from OriGene - one-time cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 2700 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3318897
Supplier Product No.: sc321759
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human FAS cDNA Clone in Mammalian Expression Vector (ABIN3318897)

Gene

FAS (TNF Receptor Superfamily, Member 6 (FAS))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321759

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human FAS is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: RsrII-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    2700 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Van Audenhove, Boucherie, Pieters, Zwaenepoel, Vanloo, Martens, Verbrugge, Hassanzadeh-Ghassabeh, Vandekerckhove, Cornelissen, De Ganck, Gettemans: "Stratifying fascin and cortactin function in invadopodium formation using inhibitory nanobodies and targeted subcellular delocalization." in: FASEB journal : official publication of the Federation of American Societies for Experimental Biology, Vol. 28, Issue 4, pp. 1805-18, (2014) (PubMed).

  • Target

    FAS (TNF Receptor Superfamily, Member 6 (FAS))

    Alternative Name

    FAS

    Background

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011].Transcript Variant: This variant (1) encodes the longest isoform (1).

    NCBI Accession

    NM_000043, NP_000034
You are here: