Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PDPK1 cDNA Clone in Mammalian Expression Vector

This is a 3-phosphoinositide Dependent Protein Kinase-1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319175
Supplier Product No.: sc321678
$754.60
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PDPK1 cDNA Clone in Mammalian Expression Vector (ABIN3319175)

Gene

PDPK1 (3-phosphoinositide Dependent Protein Kinase-1 (PDPK1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321678

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PDK1 is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: RsrII-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Pfleger, He, Abdellatif: "Mitochondrial complex II is a source of the reserve respiratory capacity that is regulated by metabolic sensors and promotes cell survival." in: Cell death & disease, Vol. 6, pp. e1835, (2015) (PubMed).

    Zhao, Ren, Tang: "Overcoming 5-Fu resistance in human non-small cell lung cancer cells by the combination of 5-Fu and cisplatin through the inhibition of glucose metabolism." in: Tumour biology, Vol. 35, Issue 12, pp. 12305-15, (2014) (PubMed).

    Newington, Rappon, Albers, Wong, Rylett, Cumming et al.: "Overexpression of pyruvate dehydrogenase kinase 1 and lactate dehydrogenase A in nerve cells confers resistance to amyloid β and other toxins by decreasing mitochondrial respiration and reactive ..." in: The Journal of biological chemistry, Vol. 287, Issue 44, pp. 37245-58, (2012) (PubMed).

    Mahadevan, Powis, Mash, George, Gokhale, Zhang, Shakalya, Du-Cuny, Berggren, Ali, Jana, Ihle, Moses, Franklin, Narayan, Shirahatti, Meuillet: "Discovery of a novel class of AKT pleckstrin homology domain inhibitors." in: Molecular cancer therapeutics, Vol. 7, Issue 9, pp. 2621-32, (2008) (PubMed).

  • Target

    PDPK1 (3-phosphoinositide Dependent Protein Kinase-1 (PDPK1))

    Alternative Name

    PDK1

    Background

    Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.

    NCBI Accession

    NM_002610, NP_002601
You are here: