Human PDPK1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human PDPK1 cDNA Clone in Mammalian Expression Vector (ABIN3319175)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc321678
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human PDK1 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: RsrII-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Mitochondrial complex II is a source of the reserve respiratory capacity that is regulated by metabolic sensors and promotes cell survival." in: Cell death & disease, Vol. 6, pp. e1835, (2015) (PubMed).
: "Overcoming 5-Fu resistance in human non-small cell lung cancer cells by the combination of 5-Fu and cisplatin through the inhibition of glucose metabolism." in: Tumour biology, Vol. 35, Issue 12, pp. 12305-15, (2014) (PubMed).
: "Overexpression of pyruvate dehydrogenase kinase 1 and lactate dehydrogenase A in nerve cells confers resistance to amyloid β and other toxins by decreasing mitochondrial respiration and reactive ..." in: The Journal of biological chemistry, Vol. 287, Issue 44, pp. 37245-58, (2012) (PubMed).
: "Discovery of a novel class of AKT pleckstrin homology domain inhibitors." in: Molecular cancer therapeutics, Vol. 7, Issue 9, pp. 2621-32, (2008) (PubMed).
-
-
- PDPK1 (3-phosphoinositide Dependent Protein Kinase-1 (PDPK1))
-
Alternative Name
- PDK1
-
Background
- Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013].Transcript Variant: This variant (2) lacks an in-frame exon in the coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.
-
NCBI Accession
- NM_002610, NP_002601
Target
-