Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human PPARG cDNA Clone in Mammalian Expression Vector

This is a Peroxisome Proliferator-Activated Receptor gamma plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 1800 bp. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319207
Supplier Product No.: sc322218
$679.14
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human PPARG cDNA Clone in Mammalian Expression Vector (ABIN3319207)

Gene

PPARG (Peroxisome Proliferator-Activated Receptor gamma (PPARG))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc322218

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human PPARG is ideal for over-expression of native protein for functional studies.

    Specificity

    Restriction Site: RsrII-NotI

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Insert Length

    1800 bp

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Panza, Votino, Gentile, Valvano, Colangelo, Pancione, Micale, Merla, Andriulli, Sabatino, Vinciguerra, Prattichizzo, Mazzoccoli, Colantuoni, Piepoli: "Peroxisome proliferator-activated receptor γ-mediated induction of microRNA-145 opposes tumor phenotype in colorectal cancer." in: Biochimica et biophysica acta, Vol. 1843, Issue 6, pp. 1225-36, (2014) (PubMed).

    Tsang, Shu, Kwok, Zhang, Lee, Tang, Li, Chan, Chan, Wan: "CD146+ human umbilical cord perivascular cells maintain stemness under hypoxia and as a cell source for skeletal regeneration." in: PLoS ONE, Vol. 8, Issue 10, pp. e76153, (2013) (PubMed).

  • Target

    PPARG (Peroxisome Proliferator-Activated Receptor gamma (PPARG))

    Alternative Name

    PPARG

    Background

    This gene encodes a member of the peroxisome proliferator-activated receptor (PPAR) subfamily of nuclear receptors. PPARs form heterodimers with retinoid X receptors (RXRs) and these heterodimers regulate transcription of various genes. Three subtypes of PPARs are known: PPAR-alpha, PPAR-delta, and PPAR-gamma. The protein encoded by this gene is PPAR-gamma and is a regulator of adipocyte differentiation. Additionally, PPAR-gamma has been implicated in the pathology of numerous diseases including obesity, diabetes, atherosclerosis and cancer. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (1) differs in the 5' UTR and 5' coding region compared to variant 2. Variants 1, 3, and 4 encode the same isoform (1), which has a shorter, distinct N-terminus compared to isoform 2.

    NCBI Accession

    NM_138712, NP_619726
You are here: