Human SOX9 cDNA Clone in Mammalian Expression Vector
This is a SRY (Sex Determining Region Y)-Box 9 plasmid from OriGene - 7 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: 2600 bp. Transient, Stable expression. Suitable for PExp.
Bacterial selection: Ampicillin.
1 image
(7 references)
Catalog No. ABIN3319363
Supplier Product No.: sc321884
$470.25
Plus shipping costs $50.00
10 μg
Shipping to:
United States
Delivery in 4 to 9 Business Days
Quick Overview for Human SOX9 cDNA Clone in Mammalian Expression Vector (ABIN3319363)
Gene
SOX9
(SRY (Sex Determining Region Y)-Box 9 (SOX9))
Application
Protein Expression (PExp)
Insert
cDNA
Vector
Mammalian Expression Vector
Vector Backbone
pCMV6-AC
Promoter
Enhanced CMV Promoter
Bacterial Resistance
Ampicillin
Expression Type
Transient, Stable
-
-
Species
- Human
-
Supplier Product No.
- sc321884
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human SOX9 is ideal for over-expression of native protein for functional studies.
-
Specificity
- Restriction Site: RsrII-NotI
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 2600 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, (2016) (PubMed).
: "Antagonistic cross-regulation between Sox9 and Sox10 controls an anti-tumorigenic program in melanoma." in: PLoS genetics, Vol. 11, Issue 1, pp. e1004877, (2015) (PubMed).
: "Sry-type HMG box 18 contributes to the differentiation of bone marrow-derived mesenchymal stem cells to endothelial cells." in: Differentiation; research in biological diversity, Vol. 89, Issue 3-4, pp. 87-96, (2015) (PubMed).
: "Sox9 expression in carcinogenesis and its clinical significance in intrahepatic cholangiocarcinoma." in: Digestive and liver disease : official journal of the Italian Society of Gastroenterology and the Italian Association for the Study of the Liver, Vol. 47, Issue 12, pp. 1067-75, (2015) (PubMed).
: "High efficiency transfection of embryonic limb mesenchyme with plasmid DNA using square wave pulse electroporation and sucrose buffer." in: BioTechniques, Vol. 56, Issue 2, pp. 85-9, (2014) (PubMed).
: "Osteochondral tissue regeneration through polymeric delivery of DNA encoding for the SOX trio and RUNX2." in: Acta biomaterialia, Vol. 10, Issue 10, pp. 4103-12, (2014) (PubMed).
: "The transcription factors Sox5 and Sox9 regulate Catsper1 gene expression." in: FEBS letters, Vol. 588, Issue 18, pp. 3352-60, (2014) (PubMed).
-
: "SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma." in: Oncogene, Vol. 35, Issue 22, pp. 2824-33, (2016) (PubMed).
-
- SOX9 (SRY (Sex Determining Region Y)-Box 9 (SOX9))
-
Alternative Name
- SOX9
-
Background
- The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008].
-
NCBI Accession
- NM_000346, NP_000337
Target
-
You are here:
