Human AKT1 cDNA Clone in Mammalian Expression Vector
Quick Overview for Human AKT1 cDNA Clone in Mammalian Expression Vector (ABIN3319563)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc320238
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human AKT1 is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
-
: "Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 154, (2015) (PubMed).
: "Plasma membrane translocation of REDD1 governed by GPCRs contributes to mTORC1 activation." in: Journal of cell science, Vol. 127, Issue Pt 4, pp. 773-87, (2014) (PubMed).
: "Extrinsic sphingosine 1-phosphate activates S1P5 and induces autophagy through generating endoplasmic reticulum stress in human prostate cancer PC-3 cells." in: Cellular signalling, Vol. 26, Issue 3, pp. 611-8, (2014) (PubMed).
: "Protection from angiotensin II-mediated vasculotoxic and hypertensive response in mice lacking PI3Kgamma." in: The Journal of experimental medicine, Vol. 201, Issue 8, pp. 1217-28, (2005) (PubMed).
-
: "Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 154, (2015) (PubMed).
-
- AKT1 (V-Akt Murine Thymoma Viral Oncogene Homolog 1 (AKT1))
-
Alternative Name
- AKT1
-
Background
- The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (3) lacks the 5' exon, but has an upstream alternate 5' exon, as compared to variant 1. Variants 1 and 3 encode the same protein.
-
NCBI Accession
- NM_001014431, NP_001014431
Target
-