Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human AKT1 cDNA Clone in Mammalian Expression Vector

This is a V-Akt Murine Thymoma Viral Oncogene Homolog 1 plasmid from OriGene - 4 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319563
Supplier Product No.: sc320238
$452.43
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human AKT1 cDNA Clone in Mammalian Expression Vector (ABIN3319563)

Gene

AKT1 (V-Akt Murine Thymoma Viral Oncogene Homolog 1 (AKT1))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc320238

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human AKT1 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Chen, Tang, Wu, Zheng, Yang, Hann: "Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells." in: Journal of experimental & clinical cancer research : CR, Vol. 34, pp. 154, (2015) (PubMed).

    Michel, Matthes, Hachet-Haas, El Baghdadi, de Mey, Pepperkok, Simpson, Galzi, Lecat: "Plasma membrane translocation of REDD1 governed by GPCRs contributes to mTORC1 activation." in: Journal of cell science, Vol. 127, Issue Pt 4, pp. 773-87, (2014) (PubMed).

    Huang, Chang, Tang, Lin, Ju, Huang, Lee: "Extrinsic sphingosine 1-phosphate activates S1P5 and induces autophagy through generating endoplasmic reticulum stress in human prostate cancer PC-3 cells." in: Cellular signalling, Vol. 26, Issue 3, pp. 611-8, (2014) (PubMed).

    Vecchione, Patrucco, Marino, Barberis, Poulet, Aretini, Maffei, Gentile, Storto, Azzolino, Brancaccio, Colussi, Bettarini, Altruda, Silengo, Tarone, Wymann, Hirsch, Lembo: "Protection from angiotensin II-mediated vasculotoxic and hypertensive response in mice lacking PI3Kgamma." in: The Journal of experimental medicine, Vol. 201, Issue 8, pp. 1217-28, (2005) (PubMed).

  • Target

    AKT1 (V-Akt Murine Thymoma Viral Oncogene Homolog 1 (AKT1))

    Alternative Name

    AKT1

    Background

    The serine-threonine protein kinase encoded by the AKT1 gene is catalytically inactive in serum-starved primary and immortalized fibroblasts. AKT1 and the related AKT2 are activated by platelet-derived growth factor. The activation is rapid and specific, and it is abrogated by mutations in the pleckstrin homology domain of AKT1. It was shown that the activation occurs through phosphatidylinositol 3-kinase. In the developing nervous system AKT is a critical mediator of growth factor-induced neuronal survival. Survival factors can suppress apoptosis in a transcription-independent manner by activating the serine/threonine kinase AKT1, which then phosphorylates and inactivates components of the apoptotic machinery. Mutations in this gene have been associated with the Proteus syndrome. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (3) lacks the 5' exon, but has an upstream alternate 5' exon, as compared to variant 1. Variants 1 and 3 encode the same protein.

    NCBI Accession

    NM_001014431, NP_001014431
You are here: