Human ARSD cDNA Clone in Mammalian Expression Vector
Quick Overview for Human ARSD cDNA Clone in Mammalian Expression Vector (ABIN3319597)
Gene
Application
Insert
Vector
Vector Backbone
Promoter
Bacterial Resistance
Expression Type
-
-
Species
- Human
-
Supplier Product No.
- sc320488
-
Supplier
- OriGene
-
Purpose
- Untagged full-length cDNA clone from Human ARSD is ideal for over-expression of native protein for functional studies.
-
Characteristics
-
- These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
- These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
- Every lot of primer is tested to provide clean sequencing of cDNA clones.
-
Purification
- The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.
-
Components
-
- The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
- The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
-
Insert Length
- 3100 bp
-
Selectable Marker
- Neomycin
-
Sequencing Primer
- VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
-
-
![Human ARSD ORF Clone in Mammalian Expression Vector (GFP tag)]()
Human ARSD ORF Clone in Mammalian Expression Vector (GFP tag)ORF PExp Mammalian Expression Vector pCMV6-AC-GFP Ampicillin CMV Promoter GFP tag Stable
![Human ARSD ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)]()
Human ARSD ORF Clone in Mammalian Expression Vector (Myc-DYKDDDDK Tag)ORF PExp Mammalian Expression Vector pCMV6-Entry Kanamycin CMV Promoter Myc-DYKDDDDK Tag Transient
![Human ARSD cDNA Clone in Mammalian Expression Vector]()
Human ARSD cDNA Clone in Mammalian Expression VectorcDNA PExp Mammalian Expression Vector pCMV6-XL4 Ampicillin Enhanced CMV Promoter unconjugated Transient
![Human ARSD shRNA in Retroviral Vector (GFP tag)]()
Human ARSD shRNA in Retroviral Vector (GFP tag)shRNA RNAi Retroviral Vector pGFP-V-RS Kanamycin U6 Promoter GFP tag Transient
![Human ARSD shRNA in Retroviral Vector]()
Human ARSD shRNA in Retroviral VectorshRNA RNAi Retroviral Vector pRS Ampicillin U6 Promoter unconjugated Transient
-
-
Restrictions
- For Research Use only
-
-
-
Format
- Lyophilized
-
Storage
- RT,-20 °C
-
Storage Comment
- The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.
-
Expiry Date
- 12 months
-
-
- Arylsulfatase D (ARSD)
-
Alternative Name
- ARSD
-
Background
- The protein encoded by this gene is a member of the sulfatase family. Sulfatases are essential for the correct composition of bone and cartilage matrix. The encoded protein is postranslationally glycosylated and localized to the lysosome. This gene is located within a cluster of similar arylsulfatase genes on chromosome X. A related pseudogene has been identified in the pseudoautosomal region of chromosome Y. [provided by RefSeq, Jul 2011].Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
-
NCBI Accession
- NM_001669, NP_001660
Target
-
