Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@genomics-online.com

Human BAT3 cDNA Clone in Mammalian Expression Vector

This is a Large Proline-Rich Protein BAT3 plasmid from OriGene - 2 times cited - with cDNA insert cloned into Mammalian Expression VectorpCMV6-AC. Insert length: not_set. Transient, Stable expression. Suitable for PExp. Bacterial selection: Ampicillin.
OriGene
Catalog No. ABIN3319618
Supplier Product No.: sc321391
$971.19
Plus shipping costs $50.00
10 μg
Shipping to: United States
Delivery in 4 to 9 Business Days

Quick Overview for Human BAT3 cDNA Clone in Mammalian Expression Vector (ABIN3319618)

Gene

BAT3 (Large Proline-Rich Protein BAT3 (BAT3))

Application

Protein Expression (PExp)

Insert

cDNA

Vector

Mammalian Expression Vector

Vector Backbone

pCMV6-AC

Promoter

Enhanced CMV Promoter

Bacterial Resistance

Ampicillin

Expression Type

Transient, Stable
  • Species

    Human

    Supplier Product No.

    sc321391

    Supplier

    OriGene

    Purpose

    Untagged full-length cDNA clone from Human BAG6 is ideal for over-expression of native protein for functional studies.

    Characteristics

    • These cDNA clones are isolated from full-length cDNA libraries and usually contain the coding sequence as well as the untranslated regions (UTRs) of the mRNA transcript appropriate to the library from which they were isolated.
    • These cDNA clones are ideal for over-expression of native proteins for functional studies. Provided as 10 μg transfection-ready plasmids.
    • Every lot of primer is tested to provide clean sequencing of cDNA clones.

    Purification

    The DNAs were purified using PowerPrep HP Plasmid isolation kits for transfection ready plasmids.

    Components

    • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
    • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

    Selectable Marker

    Neomycin

    Sequencing Primer

    VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3', XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • Restrictions

    For Research Use only
  • Format

    Lyophilized

    Storage

    RT,-20 °C

    Storage Comment

    The lyophilized plasmid is stable for up to one year when stored at ambient temperature. Following dissolution in 100 μL dH2O, store at -20 °C. Lyophilized primers are stable for up to one year when stored at ambient temperature. Following dissolution in 10 μL dH2O, store at -20 °C.

    Expiry Date

    12 months
  • Leznicki, Clancy, Schwappach, High: "Bat3 promotes the membrane integration of tail-anchored proteins." in: Journal of cell science, Vol. 123, Issue Pt 13, pp. 2170-8, (2010) (PubMed).

    Nguyen, Bar-Sela, Sun, Bisht, Cui, Kohn, Feinberg, Gius: "BAT3 and SET1A form a complex with CTCFL/BORIS to modulate H3K4 histone dimethylation and gene expression." in: Molecular and cellular biology, Vol. 28, Issue 21, pp. 6720-9, (2008) (PubMed).

  • Target

    BAT3 (Large Proline-Rich Protein BAT3 (BAT3))

    Alternative Name

    BAG6

    Background

    This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].Transcript Variant: This variant (2) differs in the 5' UTR and utilizes an alternative in-frame splice site in the 5' coding region, compared to variant 1. Variants 2, 3, and 4 encode the same isoform (b), which is 6 aa shorter than isoform a.

    NCBI Accession

    NM_080702, NP_542433
You are here: